Rmu_sc0002490.1_g000021

Belongs to the cytochrome b5 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002490.1
Physical Location & Seq
Forward (+)
75252 .. 75521
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002490.1_g000021.1.cds

Sequence Viewer

Length: 270 bp
atggggctatcaccggcggtgtttttcacaatcgctaggatggtggtcgtcatttacagatatgttaccacaatgtttatggctctcgaagattacaacaatcctccggtggtgagtagtgctaattcagaattagtgaacaagtatttcaatcccaagatcgccatgacgccaagctcaatccaagtcgaggatatgatggagcaagagcttagagcatatgatgggtctgaccccaataagcccattcttatgaccatcaaagcttag

Protein Analysis

89

Amino Acids

10.04

Weight (kDa)

4.85

Isoelectric Point (pI)

43.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 17
AcyI GRCGYC 1 cut(s) 170
AfiI CCNNNNNNNGG 1 cut(s) 190
AgsI TTSAA 1 cut(s) 151
AluBI AGCT 3 cut(s) 177, 211, 266
AluI AGCT 3 cut(s) 177, 211, 266
AsuHPI GGTGA 2 cut(s) 3, 124
BccI CCATC 4 cut(s) 34, 193, 218, 266
BfaI CTAG 1 cut(s) 36
BsaHI GRCGYC 1 cut(s) 170
BsaWI WCCGGW 1 cut(s) 106
Bsc4I CCNNNNNNNGG 1 cut(s) 190
Bse118I RCCGGY 1 cut(s) 13
BseGI GGATG 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 190
BsiSI CCGG 2 cut(s) 14, 107
BslI CCNNNNNNNGG 1 cut(s) 190
Bsp143I GATC 1 cut(s) 159
BspACI CCGC 1 cut(s) 17
BsrFI RCCGGY 1 cut(s) 13
BssAI RCCGGY 1 cut(s) 13
BssMI GATC 1 cut(s) 159
BssNI GRCGYC 1 cut(s) 170
BstACI GRCGYC 1 cut(s) 170
BstDEI CTNAG 2 cut(s) 212, 267
BstF5I GGATG 1 cut(s) 45
BstKTI GATC 1 cut(s) 162
BstMBI GATC 1 cut(s) 159
BtsCI GGATG 1 cut(s) 45
Cfr10I RCCGGY 1 cut(s) 13
CseI GACGC 1 cut(s) 178
CviAII CATG 1 cut(s) 166
CviJI RGCY 6 cut(s) 7, 83, 177, 211, 244, 266
CviKI_1 RGCY 6 cut(s) 7, 83, 177, 211, 244, 266
DdeI CTNAG 2 cut(s) 212, 267
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
FaeI CATG 1 cut(s) 169
FaiI YATR 7 cut(s) 63, 80, 167, 197, 220, 222, 254
FatI CATG 1 cut(s) 165
FauNDI CATATG 1 cut(s) 220
FokI GGATG 1 cut(s) 52
FspBI CTAG 1 cut(s) 36
HapII CCGG 2 cut(s) 14, 107
HgaI GACGC 1 cut(s) 178
Hin1I GRCGYC 1 cut(s) 170
Hin1II CATG 1 cut(s) 169
HindIII AAGCTT 1 cut(s) 264
HpaII CCGG 2 cut(s) 14, 107
HphI GGTGA 2 cut(s) 3, 124
Hpy166II GTNNAC 1 cut(s) 139
Hpy188I TCNGA 2 cut(s) 130, 232
Hpy188III TCNNGA 1 cut(s) 86
Hpy8I GTNNAC 1 cut(s) 139
HpyF3I CTNAG 2 cut(s) 212, 267
Hsp92I GRCGYC 1 cut(s) 170
Hsp92II CATG 1 cut(s) 169
Kzo9I GATC 1 cut(s) 159
LmnI GCTCC 1 cut(s) 202
LpnPI CCDG 2 cut(s) 27, 120
MaeI CTAG 1 cut(s) 36
MaeIII GTNAC 1 cut(s) 64
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 1 cut(s) 101
MluCI AATT 2 cut(s) 124, 131
MnlI CCTC 2 cut(s) 114, 184
MslI CAYNNNNRTG 1 cut(s) 251
MspI CCGG 2 cut(s) 14, 107
NdeI CATATG 1 cut(s) 220
NdeII GATC 1 cut(s) 159
NlaIII CATG 1 cut(s) 169
RseI CAYNNNNRTG 1 cut(s) 251
Sau3AI GATC 1 cut(s) 159
SetI ASST 3 cut(s) 179, 213, 268
SgrAI CRCCGGYG 1 cut(s) 13
SmiMI CAYNNNNRTG 1 cut(s) 251
Sse9I AATT 2 cut(s) 124, 131
SsiI CCGC 1 cut(s) 17
SspMI CTAG 1 cut(s) 36
TaqI TCGA 2 cut(s) 87, 189
TasI AATT 2 cut(s) 124, 131
XcmI CCANNNNNNNNNTGG 1 cut(s) 76
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.