Rmu_sc0003395.1_g000008

Belongs to the cytochrome b5 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003395.1
Physical Location & Seq
Reverse (-)
41712 .. 42023
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003395.1_g000008.1.cds

Sequence Viewer

Length: 312 bp
atgaggatatatgaggtggtgatggaaaagataacagtgtacatggggctatcaccgacagtgtttttcacaatcgctaggatggtggtcgtcatttacagatatgttaccacaatgtttatggctctcgaagattacaacaatcctccggtggtgagtagtgctaattcagaattggtgaacaagtacttcaatcctaagatcgccatgacgccaagctcaatccaagtcgaggatatgacggagcaagagcttagaggatatgatgggtctgaccccaataagcccgttcttatgaccatcaaagcttag

Protein Analysis

103

Amino Acids

11.77

Weight (kDa)

4.99

Isoelectric Point (pI)

38.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 212
AfaI GTAC 2 cut(s) 41, 188
AfiI CCNNNNNNNGG 1 cut(s) 232
AgsI TTSAA 1 cut(s) 193
AluBI AGCT 3 cut(s) 219, 253, 308
AluI AGCT 3 cut(s) 219, 253, 308
AsuHPI GGTGA 4 cut(s) 31, 45, 166, 190
BccI CCATC 4 cut(s) 16, 76, 260, 308
BfaI CTAG 1 cut(s) 78
BmcAI AGTACT 1 cut(s) 188
BsaHI GRCGYC 1 cut(s) 212
BsaWI WCCGGW 1 cut(s) 148
Bsc4I CCNNNNNNNGG 1 cut(s) 232
BseGI GGATG 1 cut(s) 87
BseLI CCNNNNNNNGG 1 cut(s) 232
BsiSI CCGG 1 cut(s) 149
BslI CCNNNNNNNGG 1 cut(s) 232
Bsp1407I TGTACA 1 cut(s) 39
Bsp143I GATC 1 cut(s) 201
BsrGI TGTACA 1 cut(s) 39
BssMI GATC 1 cut(s) 201
BssNI GRCGYC 1 cut(s) 212
Bst4CI ACNGT 2 cut(s) 37, 61
BstACI GRCGYC 1 cut(s) 212
BstAUI TGTACA 1 cut(s) 39
BstDEI CTNAG 3 cut(s) 198, 254, 309
BstF5I GGATG 1 cut(s) 87
BstKTI GATC 1 cut(s) 204
BstMBI GATC 1 cut(s) 201
BtsCI GGATG 1 cut(s) 87
BtsIMutI CAGTG 2 cut(s) 42, 66
CseI GACGC 1 cut(s) 220
Csp6I GTAC 2 cut(s) 40, 187
CviAII CATG 2 cut(s) 43, 208
CviJI RGCY 6 cut(s) 49, 125, 219, 253, 286, 308
CviKI_1 RGCY 6 cut(s) 49, 125, 219, 253, 286, 308
CviQI GTAC 2 cut(s) 40, 187
DdeI CTNAG 3 cut(s) 198, 254, 309
DpnI GATC 1 cut(s) 203
DpnII GATC 1 cut(s) 201
FaeI CATG 2 cut(s) 46, 211
FaiI YATR 9 cut(s) 10, 12, 44, 105, 122, 209, 239, 264, 296
FatI CATG 2 cut(s) 42, 207
FokI GGATG 1 cut(s) 94
FspBI CTAG 1 cut(s) 78
HapII CCGG 1 cut(s) 149
HgaI GACGC 1 cut(s) 220
Hin1I GRCGYC 1 cut(s) 212
Hin1II CATG 2 cut(s) 46, 211
HindIII AAGCTT 1 cut(s) 306
HpaII CCGG 1 cut(s) 149
HphI GGTGA 4 cut(s) 31, 45, 166, 190
Hpy166II GTNNAC 2 cut(s) 40, 181
Hpy188I TCNGA 2 cut(s) 172, 274
Hpy188III TCNNGA 1 cut(s) 128
Hpy8I GTNNAC 2 cut(s) 40, 181
HpyCH4III ACNGT 2 cut(s) 37, 61
HpyF3I CTNAG 3 cut(s) 198, 254, 309
Hsp92I GRCGYC 1 cut(s) 212
Hsp92II CATG 2 cut(s) 46, 211
Kzo9I GATC 1 cut(s) 201
LmnI GCTCC 1 cut(s) 244
LpnPI CCDG 1 cut(s) 162
MaeI CTAG 1 cut(s) 78
MaeIII GTNAC 1 cut(s) 106
MalI GATC 1 cut(s) 203
MboI GATC 1 cut(s) 201
MboII GAAGA 1 cut(s) 143
MluCI AATT 2 cut(s) 166, 173
MnlI CCTC 4 cut(s) 7, 156, 226, 251
MspI CCGG 1 cut(s) 149
NdeII GATC 1 cut(s) 201
NlaIII CATG 2 cut(s) 46, 211
RsaI GTAC 2 cut(s) 41, 188
RsaNI GTAC 2 cut(s) 40, 187
Sau3AI GATC 1 cut(s) 201
ScaI AGTACT 1 cut(s) 188
SetI ASST 4 cut(s) 18, 221, 255, 310
Sse9I AATT 2 cut(s) 166, 173
SspMI CTAG 1 cut(s) 78
TaaI ACNGT 2 cut(s) 37, 61
TaqI TCGA 2 cut(s) 129, 231
TasI AATT 2 cut(s) 166, 173
TatI WGTACW 2 cut(s) 39, 186
TscAI CASTG 2 cut(s) 42, 66
TspGWI ACGGA 1 cut(s) 257
TspRI CASTG 2 cut(s) 42, 66
XcmI CCANNNNNNNNNTGG 1 cut(s) 118
XspI CTAG 1 cut(s) 78
ZrmI AGTACT 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.