Rmu_sc0002516.1_g000014

Mitochondrial PGP phosphatase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002516.1
Physical Location & Seq
Reverse (-)
76802 .. 79096
2295 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002516.1_g000014.1.cds

Sequence Viewer

Length: 1065 bp
atgcagtcaacctcatcacctccgctgcccaaatgcccttacgctctccccaacccttctcatcacttcttccaccacccccaccacccttccaaaaaccctaacaccctctcccttccccaaaagccccaaacccacttcaccgcccactgtgccctttccatatcccacaccaacagttgcagcagagaccacccagtaaaccagaaccacaaacgcagccaccggagcaccgattccgattccgattccgattccgacccatatcactacgacgcactcttcctccaattcaactcccccggcgacaccagcaccagcaacgacgaaggcccggaaagcccattcgaagatcaaagcgaagttcacaggggagtttcgtcgaacatgtggtgggcagacttgaaagccgcattggggcagagactgaactttggggccatagtgttttcggctagggtgctcgccaaagaccagcacttggctctgcctcacgtttcggtgcctgatataaggcacattgattgggttgagcttcacaggaggggtttcaagggcgttgtgtttgataaggacaacactctcactgtgccttactctttgacgctttggggtcctcttgggtcgtcattggagcaatgtaaatcagttttcgggccagatattgcggtcttcagtaactccgctgggctgaatgaatatgaccatgatggttcgaaagctagggagcttgaaggggctatcggaattaaagtcataaggcatagattgaagaaaccagctgggacagctgaagagatcgagaagcattttggttgtaagtcgtcgcatcttattatggtgggtgatcgacccttgactgatattgtctatgggaatcaaaatggctttctaactatcttaactggacctttgagtcttgctgaggagccattcattgtcaggcaggtgaggaaactagaaacagcccttgtgaatagttggtctaggaaggggttaaaacccttgagtcataggttgttgccagatggcatgcagtgtgtgaaacatccaccacctctgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

354

Amino Acids

39.35

Weight (kDa)

7.12

Isoelectric Point (pI)

40.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 937
AasI GACNNNNNNGTC 1 cut(s) 915
Acc36I ACCTGC 1 cut(s) 937
AccB1I GGYRCC 1 cut(s) 502
AccB7I CCANNNNNTGG 1 cut(s) 481
AciI CCGC 5 cut(s) 23, 144, 411, 668, 684
AcuI CTGAAG 2 cut(s) 658, 813
AfiI CCNNNNNNNGG 2 cut(s) 417, 481
AflIII ACRYGT 1 cut(s) 387
AgsI TTSAA 5 cut(s) 295, 406, 553, 734, 772
AjuI GAANNNNNNNTTGG 2 cut(s) 398, 430
AluBI AGCT 5 cut(s) 535, 722, 730, 782, 791
AluI AGCT 5 cut(s) 535, 722, 730, 782, 791
Alw21I GWGCWC 2 cut(s) 233, 465
Alw26I GTCTC 2 cut(s) 183, 418
AlwNI CAGNNNCTG 1 cut(s) 427
AoxI GGCC 3 cut(s) 331, 438, 656
ApeKI GCWGC 3 cut(s) 25, 183, 219
AspS9I GGNCC 5 cut(s) 332, 438, 614, 656, 908
AsuC2I CCSGG 2 cut(s) 303, 335
AsuHPI GGTGA 4 cut(s) 9, 133, 857, 961
AsuII TTCGAA 2 cut(s) 348, 716
AvaII GGWCC 2 cut(s) 614, 908
BaeGI GKGCMC 1 cut(s) 157
BanI GGYRCC 1 cut(s) 502
BbsI GAAGAC 1 cut(s) 664
Bbv12I GWGCWC 2 cut(s) 233, 465
BbvCI CCTCAGC 1 cut(s) 924
BbvI GCAGC 3 cut(s) 12, 195, 231
BccI CCATC 2 cut(s) 704, 1022
BcnI CCSGG 2 cut(s) 303, 335
BcoDI GTCTC 2 cut(s) 183, 418
BfaI CTAG 4 cut(s) 456, 723, 959, 987
BfuAI ACCTGC 1 cut(s) 937
BisI GCNGC 4 cut(s) 26, 184, 220, 411
BlsI GCNGC 4 cut(s) 27, 185, 221, 412
Bme1390I CCNGG 2 cut(s) 303, 335
Bme18I GGWCC 2 cut(s) 614, 908
BmgT120I GGNCC 5 cut(s) 332, 438, 614, 656, 908
BmiI GGNNCC 4 cut(s) 439, 504, 615, 930
BmrFI CCNGG 2 cut(s) 303, 335
BmrI ACTGGG 1 cut(s) 191
BmsI GCATC 1 cut(s) 838
BmuI ACTGGG 1 cut(s) 191
BpiI GAAGAC 1 cut(s) 664
Bpu10I CCTNAGC 1 cut(s) 924
Bpu14I TTCGAA 2 cut(s) 348, 716
BpuEI CTTGAG 1 cut(s) 1027
BpuMI CCSGG 2 cut(s) 303, 335
BsaI GGTCTC 1 cut(s) 183
BsaJI CCNNGG 1 cut(s) 301
BsaWI WCCGGW 1 cut(s) 225
BsaXI ACNNNNNCTCC 4 cut(s) 95, 125, 270, 300
Bsc4I CCNNNNNNNGG 2 cut(s) 417, 481
Bse1I ACTGG 2 cut(s) 197, 910
Bse3DI GCAATG 1 cut(s) 644
BseDI CCNNGG 1 cut(s) 301
BseGI GGATG 1 cut(s) 1048
BseLI CCNNNNNNNGG 2 cut(s) 417, 481
BseMI GCAATG 1 cut(s) 644
BseMII CTCAG 1 cut(s) 915
BseNI ACTGG 2 cut(s) 197, 910
BseRI GAGGAG 1 cut(s) 941
BseSI GKGCMC 1 cut(s) 157
BseXI GCAGC 3 cut(s) 12, 195, 231
BseYI CCCAGC 2 cut(s) 686, 782
BshFI GGCC 3 cut(s) 333, 440, 658
BshNI GGYRCC 1 cut(s) 502
BsiHKAI GWGCWC 2 cut(s) 233, 465
BsiSI CCGG 3 cut(s) 226, 303, 335
BslFI GGGAC 1 cut(s) 799
BslI CCNNNNNNNGG 2 cut(s) 417, 481
BsmAI GTCTC 2 cut(s) 183, 418
BsmFI GGGAC 1 cut(s) 799
BsnI GGCC 3 cut(s) 333, 440, 658
Bso31I GGTCTC 1 cut(s) 183
Bsp119I TTCGAA 2 cut(s) 348, 716
Bsp1286I GDGCHC 3 cut(s) 157, 233, 465
Bsp143I GATC 3 cut(s) 352, 798, 847
BspACI CCGC 5 cut(s) 23, 144, 411, 668, 684
BspANI GGCC 3 cut(s) 333, 440, 658
BspCNI CTCAG 1 cut(s) 916
BspLI GGNNCC 4 cut(s) 439, 504, 615, 930
BspMI ACCTGC 1 cut(s) 937
BspT104I TTCGAA 2 cut(s) 348, 716
BspT107I GGYRCC 1 cut(s) 502
BspTNI GGTCTC 1 cut(s) 183
BsrDI GCAATG 1 cut(s) 644
BsrI ACTGG 2 cut(s) 197, 910
BssECI CCNNGG 1 cut(s) 301
BssMI GATC 3 cut(s) 352, 798, 847
Bst4CI ACNGT 3 cut(s) 152, 179, 589
Bst6I CTCTTC 2 cut(s) 287, 789
BstBI TTCGAA 2 cut(s) 348, 716
BstC8I GCNNGC 2 cut(s) 465, 1034
BstDEI CTNAG 1 cut(s) 924
BstF5I GGATG 1 cut(s) 1048
BstKTI GATC 3 cut(s) 355, 801, 850
BstMAI GTCTC 2 cut(s) 183, 418
BstMBI GATC 3 cut(s) 352, 798, 847
BstMWI GCNNNNNNNGC 5 cut(s) 152, 228, 312, 339, 788
BstNSI RCATGY 2 cut(s) 391, 1036
BstSCI CCNGG 2 cut(s) 301, 333
BstSLI GKGCMC 1 cut(s) 157
BstV1I GCAGC 3 cut(s) 12, 195, 231
BstV2I GAAGAC 1 cut(s) 664
BsuRI GGCC 3 cut(s) 333, 440, 658
BtsCI GGATG 1 cut(s) 1048
BtsI GCAGTG 1 cut(s) 1043
BtsIMutI CAGTG 3 cut(s) 148, 585, 1043
BveI ACCTGC 1 cut(s) 937
Cac8I GCNNGC 2 cut(s) 465, 1034
CaiI CAGNNNCTG 1 cut(s) 427
Cfr13I GGNCC 5 cut(s) 332, 438, 614, 656, 908
CseI GACGC 2 cut(s) 284, 613
CviAII CATG 3 cut(s) 388, 707, 1033
DdeI CTNAG 1 cut(s) 924
DpnI GATC 3 cut(s) 354, 800, 849
DpnII GATC 3 cut(s) 352, 798, 847
DrdI GACNNNNNNGTC 1 cut(s) 915
DseDI GACNNNNNNGTC 1 cut(s) 915
Eam1104I CTCTTC 2 cut(s) 287, 789
EarI CTCTTC 2 cut(s) 287, 789
Eco31I GGTCTC 1 cut(s) 183
Eco47I GGWCC 2 cut(s) 614, 908
Eco57I CTGAAG 2 cut(s) 658, 813
EcoO109I RGGNCCY 1 cut(s) 614
FaeI CATG 3 cut(s) 391, 710, 1036
FaqI GGGAC 1 cut(s) 799
FatI CATG 3 cut(s) 387, 706, 1032
Fnu4HI GCNGC 4 cut(s) 26, 184, 220, 411
FokI GGATG 1 cut(s) 1035
Fsp4HI GCNGC 4 cut(s) 26, 184, 220, 411
FspBI CTAG 4 cut(s) 456, 723, 959, 987
GluI GCNGC 4 cut(s) 26, 184, 220, 411
GsaI CCCAGC 2 cut(s) 690, 786
HaeIII GGCC 3 cut(s) 333, 440, 658
HapII CCGG 3 cut(s) 226, 303, 335
HgaI GACGC 2 cut(s) 284, 613
Hin1II CATG 3 cut(s) 391, 710, 1036
HincII GTYRAC 1 cut(s) 9
HindII GTYRAC 1 cut(s) 9
HinfI GANTC 7 cut(s) 236, 242, 248, 254, 877, 916, 1009
HpaII CCGG 3 cut(s) 226, 303, 335
HphI GGTGA 4 cut(s) 9, 133, 857, 961
Hpy166II GTNNAC 3 cut(s) 9, 202, 367
Hpy188I TCNGA 5 cut(s) 241, 247, 253, 259, 746
Hpy188III TCNNGA 1 cut(s) 802
Hpy8I GTNNAC 3 cut(s) 9, 202, 367
Hpy99I CGWCG 4 cut(s) 278, 329, 385, 829
HpyAV CCTTC 6 cut(s) 66, 99, 125, 323, 728, 985
HpyCH4III ACNGT 3 cut(s) 152, 179, 589
HpyCH4IV ACGT 1 cut(s) 495
HpyCH4V TGCA 3 cut(s) 4, 183, 1036
HpyF10VI GCNNNNNNNGC 5 cut(s) 152, 228, 312, 339, 788
HpyF3I CTNAG 1 cut(s) 924
HpySE526I ACGT 1 cut(s) 495
Hsp92II CATG 3 cut(s) 391, 710, 1036
Kzo9I GATC 3 cut(s) 352, 798, 847
LmnI GCTCC 4 cut(s) 228, 634, 727, 928
Lsp1109I GCAGC 3 cut(s) 12, 195, 231
LweI GCATC 1 cut(s) 838
MaeI CTAG 4 cut(s) 456, 723, 959, 987
MaeII ACGT 1 cut(s) 495
MaeIII GTNAC 1 cut(s) 677
MalI GATC 3 cut(s) 354, 800, 849
MboI GATC 3 cut(s) 352, 798, 847
MboII GAAGA 6 cut(s) 61, 274, 362, 664, 784, 806
MhlI GDGCHC 3 cut(s) 157, 233, 465
MluCI AATT 2 cut(s) 290, 747
MlyI GAGTC 2 cut(s) 925, 1018
MmeI TCCRAC 1 cut(s) 282
MnlI CCTC 9 cut(s) 22, 30, 119, 296, 501, 537, 627, 919, 945
MseI TTAA 3 cut(s) 750, 902, 998
MspA1I CMGCKG 4 cut(s) 25, 686, 782, 791
MspI CCGG 3 cut(s) 226, 303, 335
MspR9I CCNGG 2 cut(s) 303, 335
MwoI GCNNNNNNNGC 5 cut(s) 152, 228, 312, 339, 788
NciI CCSGG 2 cut(s) 303, 335
NdeII GATC 3 cut(s) 352, 798, 847
NlaIII CATG 3 cut(s) 391, 710, 1036
NlaIV GGNNCC 4 cut(s) 439, 504, 615, 930
NspI RCATGY 2 cut(s) 391, 1036
NspV TTCGAA 2 cut(s) 348, 716
PaeI GCATGC 1 cut(s) 1036
PaqCI CACCTGC 1 cut(s) 937
PciI ACATGT 1 cut(s) 387
PfeI GAWTC 5 cut(s) 236, 242, 248, 254, 877
PflMI CCANNNNNTGG 1 cut(s) 481
PkrI GCNGC 4 cut(s) 27, 185, 221, 412
PleI GAGTC 2 cut(s) 924, 1017
PpsI GAGTC 2 cut(s) 924, 1017
PpuMI RGGWCCY 1 cut(s) 614
PscI ACATGT 1 cut(s) 387
Psp5II RGGWCCY 1 cut(s) 614
PspFI CCCAGC 2 cut(s) 686, 782
PspN4I GGNNCC 4 cut(s) 439, 504, 615, 930
PspPI GGNCC 5 cut(s) 332, 438, 614, 656, 908
PspPPI RGGWCCY 1 cut(s) 614
PstNI CAGNNNCTG 1 cut(s) 427
PvuII CAGCTG 2 cut(s) 782, 791
SaqAI TTAA 3 cut(s) 750, 902, 998
SatI GCNGC 4 cut(s) 26, 184, 220, 411
Sau3AI GATC 3 cut(s) 352, 798, 847
Sau96I GGNCC 5 cut(s) 332, 438, 614, 656, 908
SchI GAGTC 2 cut(s) 925, 1018
ScrFI CCNGG 2 cut(s) 303, 335
SduI GDGCHC 3 cut(s) 157, 233, 465
SfaNI GCATC 1 cut(s) 838
SfuI TTCGAA 2 cut(s) 348, 716
SinI GGWCC 2 cut(s) 614, 908
SmlI CTYRAG 1 cut(s) 1006
SmoI CTYRAG 1 cut(s) 1006
SphI GCATGC 1 cut(s) 1036
Sse9I AATT 2 cut(s) 290, 747
SsiI CCGC 5 cut(s) 23, 144, 411, 668, 684
SspMI CTAG 4 cut(s) 456, 723, 959, 987
StyD4I CCNGG 2 cut(s) 301, 333
TaaI ACNGT 3 cut(s) 152, 179, 589
TaiI ACGT 1 cut(s) 498
TaqI TCGA 5 cut(s) 348, 383, 716, 801, 850
TasI AATT 2 cut(s) 290, 747
TauI GCSGC 1 cut(s) 413
TfiI GAWTC 5 cut(s) 236, 242, 248, 254, 877
Tru1I TTAA 3 cut(s) 750, 902, 998
Tru9I TTAA 3 cut(s) 750, 902, 998
TscAI CASTG 3 cut(s) 155, 592, 1043
TseI GCWGC 3 cut(s) 25, 183, 219
TspDTI ATGAA 2 cut(s) 711, 925
TspRI CASTG 3 cut(s) 155, 592, 1043
Van91I CCANNNNNTGG 1 cut(s) 481
VpaK11BI GGWCC 2 cut(s) 614, 908
XceI RCATGY 2 cut(s) 391, 1036
XspI CTAG 4 cut(s) 456, 723, 959, 987
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.