Rroxscaffold_2G00096600

Mitochondrial PGP phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0005815
Physical Location & Seq
Reverse (-)
17922224 .. 17928380
6157 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00096600.1

Sequence Viewer

Length: 342 bp
ATGATTGCGGTCTTCAGTAACTCTGCTGGGCTTAATGAATATGACCATGATGGTTTGAAAGCTAGGGAGCTTGAAGAGGCTATTGGAATTAAAGTCATAAGGCATAGATTGAAGAAACCGGCTGGGACAGCTGAAGAGATCGAGAAGCATTTTGGTTGTAAGTCGTCGCATCTTATTATGGTGGGTGATCGACCCTTGACTGATATTGTCTATGGAAATCAAAATGACTTTCTAATTACCTTAACTGGATCTTTGAGTCTTGCTGATGAGCCATTCATTGTTAGGCAGTTAAAGTTCAAGATTTGCTCTATTTCTCTCTATTACTTTACTGGCGGTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00564 ko01100 map00564 map01100
Pfam Domains
Protein Families
PGP_phosphatase

Protein Analysis

113

Amino Acids

12.59

Weight (kDa)

6.4

Isoelectric Point (pI)

19.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PGP_phosphatase PF09419 2 - 77 1.8e-21 Mitochondrial PGP phosphatase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 8, 333
AclWI GGATC 1 cut(s) 256
AcuI CTGAAG 1 cut(s) 153
AgsI TTSAA 4 cut(s) 58, 74, 112, 298
AjuI GAANNNNNNNTTGG 2 cut(s) 66, 98
AluBI AGCT 3 cut(s) 62, 70, 131
AluI AGCT 3 cut(s) 62, 70, 131
AlwI GGATC 1 cut(s) 256
AsuHPI GGTGA 1 cut(s) 197
BbsI GAAGAC 1 cut(s) 4
BccI CCATC 1 cut(s) 44
BfaI CTAG 1 cut(s) 63
BmsI GCATC 1 cut(s) 178
BpiI GAAGAC 1 cut(s) 4
Bse118I RCCGGY 1 cut(s) 118
Bse1I ACTGG 2 cut(s) 250, 334
BseNI ACTGG 2 cut(s) 250, 334
BseYI CCCAGC 2 cut(s) 26, 122
BsiSI CCGG 1 cut(s) 119
BslFI GGGAC 1 cut(s) 139
BsmFI GGGAC 1 cut(s) 139
Bsp143I GATC 3 cut(s) 138, 187, 248
BspACI CCGC 2 cut(s) 8, 333
BspPI GGATC 1 cut(s) 256
BsrFI RCCGGY 1 cut(s) 118
BsrI ACTGG 2 cut(s) 250, 334
BssAI RCCGGY 1 cut(s) 118
BssMI GATC 3 cut(s) 138, 187, 248
Bst6I CTCTTC 2 cut(s) 69, 129
BstKTI GATC 3 cut(s) 141, 190, 251
BstMBI GATC 3 cut(s) 138, 187, 248
BstMWI GCNNNNNNNGC 1 cut(s) 128
BstV2I GAAGAC 1 cut(s) 4
BstX2I RGATCY 1 cut(s) 248
BstYI RGATCY 1 cut(s) 248
Cfr10I RCCGGY 1 cut(s) 118
CviAII CATG 1 cut(s) 47
CviJI RGCY 7 cut(s) 31, 62, 70, 80, 122, 131, 271
CviKI_1 RGCY 7 cut(s) 31, 62, 70, 80, 122, 131, 271
DpnI GATC 3 cut(s) 140, 189, 250
DpnII GATC 3 cut(s) 138, 187, 248
Eam1104I CTCTTC 2 cut(s) 69, 129
EarI CTCTTC 2 cut(s) 69, 129
Eco57I CTGAAG 1 cut(s) 153
FaeI CATG 1 cut(s) 50
FaiI YATR 6 cut(s) 42, 48, 98, 105, 179, 213
FaqI GGGAC 1 cut(s) 139
FatI CATG 1 cut(s) 46
FspBI CTAG 1 cut(s) 63
GsaI CCCAGC 2 cut(s) 30, 126
HapII CCGG 1 cut(s) 119
Hin1II CATG 1 cut(s) 50
HinfI GANTC 1 cut(s) 256
HpaII CCGG 1 cut(s) 119
HphI GGTGA 1 cut(s) 197
Hpy188III TCNNGA 2 cut(s) 142, 298
Hpy99I CGWCG 1 cut(s) 169
HpyF10VI GCNNNNNNNGC 1 cut(s) 128
Hsp92II CATG 1 cut(s) 50
Kzo9I GATC 3 cut(s) 138, 187, 248
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 5 cut(s) 12, 108, 132, 231, 315
LweI GCATC 1 cut(s) 178
MaeI CTAG 1 cut(s) 63
MaeIII GTNAC 1 cut(s) 17
MalI GATC 3 cut(s) 140, 189, 250
MboI GATC 3 cut(s) 138, 187, 248
MboII GAAGA 4 cut(s) 4, 86, 124, 146
MflI RGATCY 1 cut(s) 248
MluCI AATT 3 cut(s) 87, 234, 337
MlyI GAGTC 1 cut(s) 265
MnlI CCTC 1 cut(s) 70
MseI TTAA 4 cut(s) 33, 90, 242, 290
MspA1I CMGCKG 1 cut(s) 131
MspI CCGG 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 128
NdeII GATC 3 cut(s) 138, 187, 248
NlaIII CATG 1 cut(s) 50
PleI GAGTC 1 cut(s) 264
PpsI GAGTC 1 cut(s) 264
PspFI CCCAGC 2 cut(s) 26, 122
PsuI RGATCY 1 cut(s) 248
PvuII CAGCTG 1 cut(s) 131
SaqAI TTAA 4 cut(s) 33, 90, 242, 290
Sau3AI GATC 3 cut(s) 138, 187, 248
SchI GAGTC 1 cut(s) 265
SetI ASST 4 cut(s) 64, 72, 133, 242
SfaNI GCATC 1 cut(s) 178
Sse9I AATT 3 cut(s) 87, 234, 337
SsiI CCGC 2 cut(s) 8, 333
SspMI CTAG 1 cut(s) 63
TaqI TCGA 2 cut(s) 141, 190
TasI AATT 3 cut(s) 87, 234, 337
Tru1I TTAA 4 cut(s) 33, 90, 242, 290
Tru9I TTAA 4 cut(s) 33, 90, 242, 290
TspDTI ATGAA 2 cut(s) 51, 265
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.