Rmu_sc0002558.1_g000007

four-way junction helicase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002558.1
Physical Location & Seq
Reverse (-)
28164 .. 30217
2054 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002558.1_g000007.1.cds

Sequence Viewer

Length: 1407 bp
atgcgatcgtctattcctccatatgagaccaaggttcccatcaaagttcgcattcagggtcaagattcggtatacacattcgtcaagagcattgtgtatcatcttgtacaaccagcttcaaaagcttctagttccagttcaatggaatgggttgttaaagtccgagacattgaacccgaaaatcgttgtcttttgttacatccactttccacctcgttgcctttagagccgaattcagagtcttttccagatgaattaaacgtcttggaatttcaggtatcggagttagcaagatgttatagtctgcgtaaatccaattccaatgaggccgaacacaaggtggtcgtatcctctgatcctcattggcatgcgcttatgtcttacactgtatccattgattcatccttgaagacgacacaggtcgcgtatccaacaacttgttctcgcagtaagaaattggtggagtcattgggggatctacttttagttgagaaacgtgcgaggcctttgaggcggagatgtcctcataatccaactcatcatggatgcaaggtttacaagttgaacgaacccgagaggcaatgggttgaaatgaagagcttgagtaaagatcgaagtttgtttgtgggtgactacaccagcttctctgcttctactcgagatattcccagatgcttggggaatcacatttttttctcatcagatccatacttagggtttcatcgatccaagatcaagttgtacgtgaggcttctcatggatgcggaggtggtagtggtggaggtgatagtcagcgaacacgatgaggtaggggatctcagggagcatctacaggtggcagacttccttccccctccacattatctctttatgcataaaatgtctgtgatgttcgagataattccgttcagatggcataacgttctcgaaggtgatactatagatgtagttccagtgccgcaagtgctggaacaagaaaaagatgtaaaggtgttggtgacgtccttccgtgaaagtaaaaattactttgaagaggatctcgacacggaggaaataagttgtctcttacccatttcctgcttacactgttatactagggtgttccatgaactaatgatatctagtggtccacgattcactcacttgcagaacgagaggaggtgttatacgtacactaacatacgcagcggtgacacagtacaaattgtttgtatttcaggaataaaatttaagaagttgaaggtgaatgtgattgtggattataagggaactttggtggatatacatccttttaaaaaggtgaaagagctaaggaaggagctgaaggagaagaagttacatctcccgcgacggtattacttcatcctgctcgtccaaaatgctcaatatatatcttatggacgatga

Protein Analysis

468

Amino Acids

54.28

Weight (kDa)

8.59

Isoelectric Point (pI)

47.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1263
AatII GACGTC 1 cut(s) 1004
AccI GTMKAC 1 cut(s) 72
AccII CGCG 2 cut(s) 425, 1348
AciI CCGC 5 cut(s) 514, 764, 959, 1188, 1346
AclI AACGTT 1 cut(s) 921
AclWI GGATC 6 cut(s) 350, 483, 698, 720, 822, 1044
AcsI RAATTY 3 cut(s) 232, 269, 1226
AcuI CTGAAG 1 cut(s) 1343
AcyI GRCGYC 1 cut(s) 1001
AdeI CACNNNGTG 1 cut(s) 340
AfaI GTAC 4 cut(s) 108, 743, 1172, 1200
AfiI CCNNNNNNNGG 1 cut(s) 713
AgsI TTSAA 8 cut(s) 120, 141, 173, 409, 565, 590, 1031, 1240
AjuI GAANNNNNNNTTGG 2 cut(s) 424, 456
AluBI AGCT 6 cut(s) 116, 125, 600, 642, 1309, 1321
AluI AGCT 6 cut(s) 116, 125, 600, 642, 1309, 1321
Alw26I GTCTC 3 cut(s) 20, 159, 1067
AlwI GGATC 6 cut(s) 350, 483, 698, 720, 822, 1044
Ama87I CYCGRG 2 cut(s) 572, 657
AoxI GGCC 2 cut(s) 327, 503
ApeKI GCWGC 1 cut(s) 1185
ApoI RAATTY 3 cut(s) 232, 269, 1226
ArsI GACNNNNNNTTYG 2 cut(s) 224, 256
AspLEI GCGC 1 cut(s) 373
AspS9I GGNCC 1 cut(s) 1127
AsuHPI GGTGA 7 cut(s) 641, 796, 944, 1009, 1202, 1255, 1312
AvaI CYCGRG 2 cut(s) 572, 657
AvaII GGWCC 1 cut(s) 1127
BbsI GAAGAC 1 cut(s) 416
BbvI GCAGC 1 cut(s) 1197
BccI CCATC 2 cut(s) 47, 906
BciVI GTATCC 3 cut(s) 358, 400, 438
BcoDI GTCTC 3 cut(s) 20, 159, 1067
BfaI CTAG 3 cut(s) 129, 1095, 1122
BfmI CTRYAG 2 cut(s) 830, 939
BfuI GTATCC 3 cut(s) 358, 400, 438
BglI GCCNNNNNGGC 1 cut(s) 511
BisI GCNGC 2 cut(s) 959, 1186
BlsI GCNGC 2 cut(s) 960, 1187
Bme18I GGWCC 1 cut(s) 1127
BmeT110I CYCGRG 2 cut(s) 572, 657
BmgT120I GGNCC 1 cut(s) 1127
BmiI GGNNCC 1 cut(s) 36
BmsI GCATC 4 cut(s) 536, 662, 751, 835
BoxI GACNNNNGTC 1 cut(s) 419
BpiI GAAGAC 1 cut(s) 416
BplI GAGNNNNNCTC 2 cut(s) 508, 540
Bpu10I CCTNAGC 1 cut(s) 1310
BpuEI CTTGAG 1 cut(s) 622
Bsa29I ATCGAT 1 cut(s) 724
BsaAI YACGTR 2 cut(s) 745, 1170
BsaBI GATNNNNATC 1 cut(s) 1284
BsaHI GRCGYC 1 cut(s) 1001
BsaI GGTCTC 1 cut(s) 20
BsaJI CCNNGG 1 cut(s) 30
BsaXI ACNNNNNCTCC 2 cut(s) 1319, 1349
Bsc4I CCNNNNNNNGG 1 cut(s) 713
Bse1I ACTGG 2 cut(s) 135, 953
Bse3DI GCAATG 1 cut(s) 587
Bse8I GATNNNNATC 1 cut(s) 1284
BseCI ATCGAT 1 cut(s) 724
BseDI CCNNGG 1 cut(s) 30
BseGI GGATG 6 cut(s) 199, 401, 551, 766, 1285, 1362
BseJI GATNNNNATC 1 cut(s) 1284
BseLI CCNNNNNNNGG 1 cut(s) 713
BseMI GCAATG 1 cut(s) 587
BseMII CTCAG 1 cut(s) 832
BseNI ACTGG 2 cut(s) 135, 953
BseRI GAGGAG 1 cut(s) 1171
BseXI GCAGC 1 cut(s) 1197
Bsh1236I CGCG 2 cut(s) 425, 1348
Bsh1285I CGRYCG 1 cut(s) 8
BshFI GGCC 2 cut(s) 329, 505
BshVI ATCGAT 1 cut(s) 724
BsiEI CGRYCG 1 cut(s) 8
BsiHKCI CYCGRG 2 cut(s) 572, 657
BslI CCNNNNNNNGG 1 cut(s) 713
BsmAI GTCTC 3 cut(s) 20, 159, 1067
BsmI GAATGC 1 cut(s) 51
BsnI GGCC 2 cut(s) 329, 505
Bso31I GGTCTC 1 cut(s) 20
BsoBI CYCGRG 2 cut(s) 572, 657
Bsp1407I TGTACA 1 cut(s) 106
Bsp143I GATC 9 cut(s) 5, 355, 475, 610, 703, 725, 732, 814, 1036
BspACI CCGC 5 cut(s) 514, 764, 959, 1188, 1346
BspANI GGCC 2 cut(s) 329, 505
BspCNI CTCAG 1 cut(s) 831
BspDI ATCGAT 1 cut(s) 724
BspFNI CGCG 2 cut(s) 425, 1348
BspLI GGNNCC 1 cut(s) 36
BspPI GGATC 6 cut(s) 350, 483, 698, 720, 822, 1044
BspQI GCTCTTC 1 cut(s) 590
BspTNI GGTCTC 1 cut(s) 20
BsrDI GCAATG 1 cut(s) 587
BsrGI TGTACA 1 cut(s) 106
BsrI ACTGG 2 cut(s) 135, 953
BssECI CCNNGG 1 cut(s) 30
BssMI GATC 9 cut(s) 5, 355, 475, 610, 703, 725, 732, 814, 1036
BssNAI GTATAC 1 cut(s) 73
BssNI GRCGYC 1 cut(s) 1001
BssT1I CCWWGG 1 cut(s) 30
Bst1107I GTATAC 1 cut(s) 73
Bst4CI ACNGT 4 cut(s) 388, 1088, 1198, 1353
Bst6I CTCTTC 2 cut(s) 590, 1026
BstACI GRCGYC 1 cut(s) 1001
BstAUI TGTACA 1 cut(s) 106
BstBAI YACGTR 2 cut(s) 745, 1170
BstC8I GCNNGC 1 cut(s) 369
BstDEI CTNAG 3 cut(s) 712, 818, 1310
BstF5I GGATG 6 cut(s) 199, 401, 551, 766, 1285, 1362
BstFNI CGCG 2 cut(s) 425, 1348
BstHHI GCGC 1 cut(s) 373
BstKTI GATC 9 cut(s) 8, 358, 478, 613, 706, 728, 735, 817, 1039
BstMAI GTCTC 3 cut(s) 20, 159, 1067
BstMBI GATC 9 cut(s) 5, 355, 475, 610, 703, 725, 732, 814, 1036
BstMCI CGRYCG 1 cut(s) 8
BstMWI GCNNNNNNNGC 4 cut(s) 122, 226, 511, 964
BstNSI RCATGY 1 cut(s) 371
BstPAI GACNNNNGTC 1 cut(s) 419
BstSFI CTRYAG 2 cut(s) 830, 939
BstSNI TACGTA 1 cut(s) 1170
BstUI CGCG 2 cut(s) 425, 1348
BstV1I GCAGC 1 cut(s) 1197
BstV2I GAAGAC 1 cut(s) 416
BstX2I RGATCY 4 cut(s) 475, 703, 814, 1036
BstXI CCANNNNNNTGG 2 cut(s) 142, 676
BstYI RGATCY 4 cut(s) 475, 703, 814, 1036
BstZ17I GTATAC 1 cut(s) 73
Bsu15I ATCGAT 1 cut(s) 724
BsuI GTATCC 3 cut(s) 358, 400, 438
BsuRI GGCC 2 cut(s) 329, 505
BsuTUI ATCGAT 1 cut(s) 724
BtsCI GGATG 6 cut(s) 199, 401, 551, 766, 1285, 1362
BtsIMutI CAGTG 3 cut(s) 384, 960, 1084
Cac8I GCNNGC 1 cut(s) 369
CfoI GCGC 1 cut(s) 373
Cfr13I GGNCC 1 cut(s) 1127
ClaI ATCGAT 1 cut(s) 724
Csp6I GTAC 4 cut(s) 107, 742, 1171, 1199
CviAII CATG 4 cut(s) 368, 542, 757, 1106
CviQI GTAC 4 cut(s) 107, 742, 1171, 1199
DdeI CTNAG 3 cut(s) 712, 818, 1310
DpnI GATC 9 cut(s) 7, 357, 477, 612, 705, 727, 734, 816, 1038
DpnII GATC 9 cut(s) 5, 355, 475, 610, 703, 725, 732, 814, 1036
DraI TTTAAA 1 cut(s) 1294
DraIII CACNNNGTG 1 cut(s) 340
Eam1104I CTCTTC 2 cut(s) 590, 1026
EarI CTCTTC 2 cut(s) 590, 1026
EciI GGCGGA 1 cut(s) 529
Eco105I TACGTA 1 cut(s) 1170
Eco130I CCWWGG 1 cut(s) 30
Eco147I AGGCCT 1 cut(s) 505
Eco31I GGTCTC 1 cut(s) 20
Eco32I GATATC 1 cut(s) 1119
Eco47I GGWCC 1 cut(s) 1127
Eco57I CTGAAG 1 cut(s) 1343
Eco88I CYCGRG 2 cut(s) 572, 657
EcoRI GAATTC 1 cut(s) 232
EcoRV GATATC 1 cut(s) 1119
EcoT14I CCWWGG 1 cut(s) 30
EcoT22I ATGCAT 1 cut(s) 876
ErhI CCWWGG 1 cut(s) 30
FaeI CATG 4 cut(s) 371, 545, 760, 1109
FatI CATG 4 cut(s) 367, 541, 756, 1105
FauI CCCGC 1 cut(s) 1353
FauNDI CATATG 1 cut(s) 22
FblI GTMKAC 1 cut(s) 72
Fnu4HI GCNGC 2 cut(s) 959, 1186
FokI GGATG 6 cut(s) 186, 388, 558, 773, 1272, 1349
Fsp4HI GCNGC 2 cut(s) 959, 1186
FspBI CTAG 3 cut(s) 129, 1095, 1122
GlaI GCGC 1 cut(s) 372
GluI GCNGC 2 cut(s) 959, 1186
HaeIII GGCC 2 cut(s) 329, 505
HhaI GCGC 1 cut(s) 373
Hin1I GRCGYC 1 cut(s) 1001
Hin1II CATG 4 cut(s) 371, 545, 760, 1109
Hin6I GCGC 1 cut(s) 371
HinP1I GCGC 1 cut(s) 371
HindIII AAGCTT 1 cut(s) 123
HinfI GANTC 6 cut(s) 65, 239, 398, 464, 682, 1134
HphI GGTGA 7 cut(s) 641, 796, 944, 1009, 1202, 1255, 1312
Hpy166II GTNNAC 4 cut(s) 73, 556, 1130, 1173
Hpy188I TCNGA 6 cut(s) 164, 238, 283, 355, 703, 911
Hpy188III TCNNGA 8 cut(s) 62, 85, 248, 659, 895, 926, 1040, 1218
Hpy8I GTNNAC 4 cut(s) 73, 556, 1130, 1173
Hpy99I CGWCG 1 cut(s) 1353
HpyAV CCTTC 6 cut(s) 857, 923, 1015, 1234, 1309, 1318
HpyCH4III ACNGT 4 cut(s) 388, 1088, 1198, 1353
HpyCH4IV ACGT 6 cut(s) 261, 496, 744, 921, 1001, 1169
HpyCH4V TGCA 3 cut(s) 549, 874, 1147
HpyF10VI GCNNNNNNNGC 4 cut(s) 122, 226, 511, 964
HpyF3I CTNAG 3 cut(s) 712, 818, 1310
HpySE526I ACGT 6 cut(s) 261, 496, 744, 921, 1001, 1169
Hsp92I GRCGYC 1 cut(s) 1001
Hsp92II CATG 4 cut(s) 371, 545, 760, 1109
HspAI GCGC 1 cut(s) 371
Kzo9I GATC 9 cut(s) 5, 355, 475, 610, 703, 725, 732, 814, 1036
LguI GCTCTTC 1 cut(s) 590
LmnI GCTCC 2 cut(s) 823, 1318
Lsp1109I GCAGC 1 cut(s) 1197
LweI GCATC 4 cut(s) 536, 662, 751, 835
MaeI CTAG 3 cut(s) 129, 1095, 1122
MaeII ACGT 6 cut(s) 261, 496, 744, 921, 1001, 1169
MaeIII GTNAC 5 cut(s) 195, 629, 997, 1190, 1335
MalI GATC 9 cut(s) 7, 357, 477, 612, 705, 727, 734, 816, 1038
MboI GATC 9 cut(s) 5, 355, 475, 610, 703, 725, 732, 814, 1036
MboII GAAGA 4 cut(s) 421, 607, 1043, 1342
MflI RGATCY 4 cut(s) 475, 703, 814, 1036
MluCI AATT 9 cut(s) 232, 254, 269, 316, 455, 900, 1021, 1203, 1226
MlyI GAGTC 2 cut(s) 248, 473
MmeI TCCRAC 2 cut(s) 455, 557
Mph1103I ATGCAT 1 cut(s) 876
MseI TTAA 4 cut(s) 156, 257, 1230, 1293
MslI CAYNNNNRTG 1 cut(s) 366
MspA1I CMGCKG 1 cut(s) 1188
Mva1269I GAATGC 1 cut(s) 51
MvnI CGCG 2 cut(s) 425, 1348
MwoI GCNNNNNNNGC 4 cut(s) 122, 226, 511, 964
NdeI CATATG 1 cut(s) 22
NdeII GATC 9 cut(s) 5, 355, 475, 610, 703, 725, 732, 814, 1036
NlaIII CATG 4 cut(s) 371, 545, 760, 1109
NlaIV GGNNCC 1 cut(s) 36
NmuCI GTSAC 3 cut(s) 629, 997, 1190
NsiI ATGCAT 1 cut(s) 876
NspI RCATGY 1 cut(s) 371
PaeI GCATGC 1 cut(s) 371
PaeR7I CTCGAG 1 cut(s) 657
PceI AGGCCT 1 cut(s) 505
PciSI GCTCTTC 1 cut(s) 590
PctI GAATGC 1 cut(s) 51
PfeI GAWTC 4 cut(s) 65, 398, 682, 1134
PkrI GCNGC 2 cut(s) 960, 1187
Ple19I CGATCG 1 cut(s) 8
PleI GAGTC 2 cut(s) 247, 472
PpsI GAGTC 2 cut(s) 247, 472
Ppu21I YACGTR 2 cut(s) 745, 1170
PshAI GACNNNNGTC 1 cut(s) 419
PsiI TTATAA 1 cut(s) 1263
Psp1406I AACGTT 1 cut(s) 921
PspN4I GGNNCC 1 cut(s) 36
PspPI GGNCC 1 cut(s) 1127
PsuI RGATCY 4 cut(s) 475, 703, 814, 1036
PvuI CGATCG 1 cut(s) 8
RsaI GTAC 4 cut(s) 108, 743, 1172, 1200
RsaNI GTAC 4 cut(s) 107, 742, 1171, 1199
RseI CAYNNNNRTG 1 cut(s) 366
SapI GCTCTTC 1 cut(s) 590
SaqAI TTAA 4 cut(s) 156, 257, 1230, 1293
SatI GCNGC 2 cut(s) 959, 1186
Sau3AI GATC 9 cut(s) 5, 355, 475, 610, 703, 725, 732, 814, 1036
Sau96I GGNCC 1 cut(s) 1127
SchI GAGTC 2 cut(s) 248, 473
SfaNI GCATC 4 cut(s) 536, 662, 751, 835
SfcI CTRYAG 2 cut(s) 830, 939
Sfr274I CTCGAG 1 cut(s) 657
SinI GGWCC 1 cut(s) 1127
SlaI CTCGAG 1 cut(s) 657
SmiMI CAYNNNNRTG 1 cut(s) 366
SmlI CTYRAG 2 cut(s) 601, 657
SmoI CTYRAG 2 cut(s) 601, 657
SnaBI TACGTA 1 cut(s) 1170
SphI GCATGC 1 cut(s) 371
Sse9I AATT 9 cut(s) 232, 254, 269, 316, 455, 900, 1021, 1203, 1226
SseBI AGGCCT 1 cut(s) 505
SsiI CCGC 5 cut(s) 514, 764, 959, 1188, 1346
SspMI CTAG 3 cut(s) 129, 1095, 1122
StuI AGGCCT 1 cut(s) 505
StyI CCWWGG 1 cut(s) 30
TaaI ACNGT 4 cut(s) 388, 1088, 1198, 1353
TaiI ACGT 6 cut(s) 264, 499, 747, 924, 1004, 1172
TaqI TCGA 6 cut(s) 613, 658, 724, 894, 927, 1041
TasI AATT 9 cut(s) 232, 254, 269, 316, 455, 900, 1021, 1203, 1226
TatI WGTACW 2 cut(s) 106, 1198
TauI GCSGC 1 cut(s) 961
TfiI GAWTC 4 cut(s) 65, 398, 682, 1134
Tru1I TTAA 4 cut(s) 156, 257, 1230, 1293
Tru9I TTAA 4 cut(s) 156, 257, 1230, 1293
TscAI CASTG 3 cut(s) 391, 960, 1091
TseFI GTSAC 3 cut(s) 629, 997, 1190
TseI GCWGC 1 cut(s) 1185
Tsp45I GTSAC 3 cut(s) 629, 997, 1190
TspDTI ATGAA 6 cut(s) 267, 390, 608, 710, 1122, 1351
TspGWI ACGGA 3 cut(s) 894, 998, 1061
TspRI CASTG 3 cut(s) 391, 960, 1091
VpaK11BI GGWCC 1 cut(s) 1127
XapI RAATTY 3 cut(s) 232, 269, 1226
XceI RCATGY 1 cut(s) 371
XhoI CTCGAG 1 cut(s) 657
XmiI GTMKAC 1 cut(s) 72
XspI CTAG 3 cut(s) 129, 1095, 1122
ZraI GACGTC 1 cut(s) 1002
Zsp2I ATGCAT 1 cut(s) 876
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.