Rmu_sc0002908.1_g000022

Peptidyl-prolyl

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002908.1
Physical Location & Seq
Forward (+)
92507 .. 92900
394 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002908.1_g000022.1.cds

Sequence Viewer

Length: 261 bp
atgatcgaatcggccttgtctctcaaagttggcgaggagagagaattcgctacctatggcttgaagaagaagctcctcaagtctggaaccggctgggaaatcgtggagttctgcgatgaagccaccgatgaagagatggaggagacagtcactgttaagattggtgagggtggagtagtgaaggggttggagcatggcattatcactatgaagaagggagaattatactcattcggaatggtgtcgttgggcttgcattga

Protein Analysis

86

Amino Acids

9.44

Weight (kDa)

4.87

Isoelectric Point (pI)

15.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 44
AgsI TTSAA 1 cut(s) 64
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
Alw26I GTCTC 2 cut(s) 24, 137
AlwNI CAGNNNCTG 1 cut(s) 152
AoxI GGCC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 44
AsuHPI GGTGA 1 cut(s) 176
BccI CCATC 1 cut(s) 130
BcoDI GTCTC 2 cut(s) 24, 137
BmiI GGNNCC 1 cut(s) 88
BpuEI CTTGAG 1 cut(s) 62
Bse118I RCCGGY 1 cut(s) 89
BseRI GAGGAG 3 cut(s) 50, 65, 155
BseYI CCCAGC 1 cut(s) 93
BshFI GGCC 1 cut(s) 14
BsiSI CCGG 1 cut(s) 90
BsmAI GTCTC 2 cut(s) 24, 137
BsnI GGCC 1 cut(s) 14
Bsp143I GATC 1 cut(s) 3
BspANI GGCC 1 cut(s) 14
BspLI GGNNCC 1 cut(s) 88
BsrFI RCCGGY 1 cut(s) 89
BssAI RCCGGY 1 cut(s) 89
BssMI GATC 1 cut(s) 3
Bst4CI ACNGT 2 cut(s) 148, 154
Bst6I CTCTTC 1 cut(s) 126
BstC8I GCNNGC 1 cut(s) 254
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 2 cut(s) 24, 137
BstMBI GATC 1 cut(s) 3
BsuRI GGCC 1 cut(s) 14
BtgZI GCGATG 1 cut(s) 129
BtsIMutI CAGTG 1 cut(s) 150
Cac8I GCNNGC 1 cut(s) 254
CaiI CAGNNNCTG 1 cut(s) 152
Cfr10I RCCGGY 1 cut(s) 89
CviAII CATG 1 cut(s) 194
CviJI RGCY 6 cut(s) 14, 60, 73, 93, 122, 252
CviKI_1 RGCY 6 cut(s) 14, 60, 73, 93, 122, 252
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 126
EarI CTCTTC 1 cut(s) 126
EcoRI GAATTC 1 cut(s) 44
FaeI CATG 1 cut(s) 197
FaiI YATR 4 cut(s) 57, 195, 209, 226
FatI CATG 1 cut(s) 193
GsaI CCCAGC 1 cut(s) 97
HaeIII GGCC 1 cut(s) 14
HapII CCGG 1 cut(s) 90
Hin1II CATG 1 cut(s) 197
HinfI GANTC 1 cut(s) 8
HpaII CCGG 1 cut(s) 90
HphI GGTGA 1 cut(s) 176
Hpy188I TCNGA 1 cut(s) 236
Hpy188III TCNNGA 1 cut(s) 84
HpyAV CCTTC 2 cut(s) 175, 208
HpyCH4III ACNGT 2 cut(s) 148, 154
HpyCH4V TGCA 1 cut(s) 256
Hsp92II CATG 1 cut(s) 197
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 2 cut(s) 78, 190
LpnPI CCDG 3 cut(s) 69, 79, 103
MaeIII GTNAC 1 cut(s) 148
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 4 cut(s) 76, 79, 143, 223
MluCI AATT 2 cut(s) 44, 221
MmeI TCCRAC 1 cut(s) 168
MnlI CCTC 4 cut(s) 28, 86, 133, 160
MseI TTAA 1 cut(s) 156
MspI CCGG 1 cut(s) 90
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 197
NlaIV GGNNCC 1 cut(s) 88
NmuCI GTSAC 1 cut(s) 148
PfeI GAWTC 1 cut(s) 8
PspFI CCCAGC 1 cut(s) 93
PspN4I GGNNCC 1 cut(s) 88
PstNI CAGNNNCTG 1 cut(s) 152
SaqAI TTAA 1 cut(s) 156
Sau3AI GATC 1 cut(s) 3
SetI ASST 2 cut(s) 56, 75
SgeI CNNG 9 cut(s) 28, 46, 73, 91, 96, 102, 106, 115, 206
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 2 cut(s) 44, 221
TaaI ACNGT 2 cut(s) 148, 154
TaqI TCGA 1 cut(s) 6
TasI AATT 2 cut(s) 44, 221
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TscAI CASTG 1 cut(s) 157
TseFI GTSAC 1 cut(s) 148
Tsp45I GTSAC 1 cut(s) 148
TspDTI ATGAA 3 cut(s) 132, 144, 224
TspRI CASTG 1 cut(s) 157
XapI RAATTY 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.