Rmu_sc0002944.1_g000022

Leucine-rich repeats, typical (most populated) subfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002944.1
Physical Location & Seq
Reverse (-)
95308 .. 101395
6088 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002944.1_g000022.1.cds

Sequence Viewer

Length: 885 bp
atgtacaggaaagatgatgtctgggtgggtcgtctaatttcgggttattcgttaccaatggaagatccgagcctgtccaagacagaaacaaaaacaaaagatattggtggaacttggaaacaatcaatcaaagtagcacttgaggctacgcaatcggctttccctggaggagagccttatgttctggctattcccgaggaagtctggggggattctagaacttctgcaagagttcttgacctcagcaacaatgttattcaagaagtacctgccttgattgcctgtatgaattccctgcagaaacttttactcgattcaaacgatatatcggacgactctgttagctgggaagcactaaaatctttaaagtctttaactgttctttctcttaaccaaaaccgtttaactagattgtcatcggatctgggctggttgccatcattaaggcaacttcatgttgcgaacaacatgttgtctggcctcccaagtgaattgcgatatctgcctaagcttgaagttctgaaagtcaacaataacaggatcaccaccattcctccatggataggggaccttatttctcttattgaggttgatctttcatcaaatcttctgtcagatttgcccgagacatttagcaatttgcataatctaaagtccctgtctctcagtaataatgggctgaaatctctcccttcttcgctattcaaaatgtgcctaatgctcacaagacttgacttgcacaacacagaaataaccatggatatccttcgtcagattgagggatgggaaaactttgatgaacgccgtcgcttgaagcaacagaagaaactggatttttttgttgtgggctctgctgcatttgatgaaggtgctgataaaagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

294

Amino Acids

32.94

Weight (kDa)

5.39

Isoelectric Point (pI)

46.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 277
AclWI GGATC 3 cut(s) 59, 429, 548
AcsI RAATTY 1 cut(s) 289
AfaI GTAC 2 cut(s) 5, 267
AfiI CCNNNNNNNGG 1 cut(s) 563
AflIII ACRYGT 1 cut(s) 468
AgsI TTSAA 5 cut(s) 260, 318, 515, 706, 814
AjnI CCWGG 1 cut(s) 163
AluBI AGCT 3 cut(s) 345, 511, 882
AluI AGCT 3 cut(s) 345, 511, 882
Alw26I GTCTC 2 cut(s) 620, 666
AlwI GGATC 3 cut(s) 59, 429, 548
Ama87I CYCGRG 2 cut(s) 194, 623
AoxI GGCC 1 cut(s) 478
ApeKI GCWGC 1 cut(s) 854
ApoI RAATTY 1 cut(s) 289
ArsI GACNNNNNNTTYG 2 cut(s) 596, 628
AspS9I GGNCC 1 cut(s) 568
AsuHPI GGTGA 1 cut(s) 535
AvaI CYCGRG 2 cut(s) 194, 623
AvaII GGWCC 1 cut(s) 568
BanII GRGCYC 1 cut(s) 851
BbvCI CCTCAGC 1 cut(s) 242
BbvI GCAGC 1 cut(s) 841
BccI CCATC 2 cut(s) 445, 777
BceAI ACGGC 1 cut(s) 789
BciT130I CCWGG 1 cut(s) 165
BcoDI GTCTC 2 cut(s) 620, 666
BfaI CTAG 2 cut(s) 216, 408
BfmI CTRYAG 1 cut(s) 296
BfuAI ACCTGC 1 cut(s) 277
BisI GCNGC 1 cut(s) 855
BlsI GCNGC 1 cut(s) 856
Bme1390I CCNGG 1 cut(s) 165
Bme18I GGWCC 1 cut(s) 568
BmeT110I CYCGRG 2 cut(s) 194, 623
BmgT120I GGNCC 1 cut(s) 568
BmiI GGNNCC 1 cut(s) 569
BmrFI CCNGG 1 cut(s) 165
BpmI CTGGAG 1 cut(s) 186
Bpu10I CCTNAGC 2 cut(s) 242, 507
BpuEI CTTGAG 1 cut(s) 161
BsaBI GATNNNNATC 1 cut(s) 415
BsaJI CCNNGG 4 cut(s) 163, 195, 557, 756
BsaXI ACNNNNNCTCC 2 cut(s) 538, 568
Bsc4I CCNNNNNNNGG 1 cut(s) 563
Bse1I ACTGG 1 cut(s) 834
Bse8I GATNNNNATC 1 cut(s) 415
BseBI CCWGG 1 cut(s) 165
BseDI CCNNGG 4 cut(s) 163, 195, 557, 756
BseGI GGATG 1 cut(s) 788
BseJI GATNNNNATC 1 cut(s) 415
BseLI CCNNNNNNNGG 1 cut(s) 563
BseMII CTCAG 2 cut(s) 256, 679
BseNI ACTGG 1 cut(s) 834
BseRI GAGGAG 1 cut(s) 183
BseXI GCAGC 1 cut(s) 841
BseYI CCCAGC 1 cut(s) 345
BshFI GGCC 1 cut(s) 480
BsiHKCI CYCGRG 2 cut(s) 194, 623
BslFI GGGAC 2 cut(s) 581, 640
BslI CCNNNNNNNGG 1 cut(s) 563
BsmAI GTCTC 2 cut(s) 620, 666
BsmFI GGGAC 2 cut(s) 581, 640
BsnI GGCC 1 cut(s) 480
BsoBI CYCGRG 2 cut(s) 194, 623
Bsp1286I GDGCHC 1 cut(s) 851
Bsp1407I TGTACA 1 cut(s) 3
Bsp143I GATC 4 cut(s) 64, 421, 540, 592
Bsp19I CCATGG 2 cut(s) 557, 756
BspANI GGCC 1 cut(s) 480
BspCNI CTCAG 2 cut(s) 255, 678
BspLI GGNNCC 1 cut(s) 569
BspMAI CTGCAG 1 cut(s) 300
BspMI ACCTGC 1 cut(s) 277
BspPI GGATC 3 cut(s) 59, 429, 548
BsrGI TGTACA 1 cut(s) 3
BsrI ACTGG 1 cut(s) 834
BssECI CCNNGG 4 cut(s) 163, 195, 557, 756
BssMI GATC 4 cut(s) 64, 421, 540, 592
BssT1I CCWWGG 2 cut(s) 557, 756
Bst2UI CCWGG 1 cut(s) 165
Bst4CI ACNGT 2 cut(s) 379, 401
BstAUI TGTACA 1 cut(s) 3
BstDEI CTNAG 3 cut(s) 242, 507, 665
BstDSI CCRYGG 2 cut(s) 557, 756
BstF5I GGATG 1 cut(s) 788
BstKTI GATC 4 cut(s) 67, 424, 543, 595
BstMAI GTCTC 2 cut(s) 620, 666
BstMBI GATC 4 cut(s) 64, 421, 540, 592
BstMWI GCNNNNNNNGC 3 cut(s) 143, 278, 502
BstNI CCWGG 1 cut(s) 165
BstNSI RCATGY 1 cut(s) 472
BstSCI CCNGG 1 cut(s) 163
BstSFI CTRYAG 1 cut(s) 296
BstV1I GCAGC 1 cut(s) 841
BstX2I RGATCY 2 cut(s) 64, 421
BstYI RGATCY 2 cut(s) 64, 421
BsuRI GGCC 1 cut(s) 480
BtgI CCRYGG 2 cut(s) 557, 756
BtsCI GGATG 1 cut(s) 788
BveI ACCTGC 1 cut(s) 277
Cfr13I GGNCC 1 cut(s) 568
Csp6I GTAC 2 cut(s) 4, 266
CviAII CATG 4 cut(s) 455, 469, 558, 757
CviQI GTAC 2 cut(s) 4, 266
DdeI CTNAG 3 cut(s) 242, 507, 665
DpnI GATC 4 cut(s) 66, 423, 542, 594
DpnII GATC 4 cut(s) 64, 421, 540, 592
DraI TTTAAA 1 cut(s) 366
Eco130I CCWWGG 2 cut(s) 557, 756
Eco24I GRGCYC 1 cut(s) 851
Eco32I GATATC 2 cut(s) 500, 763
Eco47I GGWCC 1 cut(s) 568
Eco88I CYCGRG 2 cut(s) 194, 623
EcoO109I RGGNCCY 1 cut(s) 568
EcoRI GAATTC 1 cut(s) 289
EcoRII CCWGG 1 cut(s) 163
EcoRV GATATC 2 cut(s) 500, 763
EcoT14I CCWWGG 2 cut(s) 557, 756
EcoT38I GRGCYC 1 cut(s) 851
ErhI CCWWGG 2 cut(s) 557, 756
FaeI CATG 4 cut(s) 458, 472, 561, 760
FaiI YATR 8 cut(s) 180, 287, 326, 456, 470, 559, 645, 758
FalI AAGNNNNNCTT 2 cut(s) 123, 155
FaqI GGGAC 2 cut(s) 581, 640
FatI CATG 4 cut(s) 454, 468, 557, 756
Fnu4HI GCNGC 1 cut(s) 855
FokI GGATG 1 cut(s) 795
FriOI GRGCYC 1 cut(s) 851
Fsp4HI GCNGC 1 cut(s) 855
FspBI CTAG 2 cut(s) 216, 408
GluI GCNGC 1 cut(s) 855
GsaI CCCAGC 1 cut(s) 349
GsuI CTGGAG 1 cut(s) 186
HaeIII GGCC 1 cut(s) 480
Hin1II CATG 4 cut(s) 458, 472, 561, 760
HincII GTYRAC 1 cut(s) 529
HindII GTYRAC 1 cut(s) 529
HindIII AAGCTT 1 cut(s) 509
HinfI GANTC 3 cut(s) 212, 314, 335
HphI GGTGA 1 cut(s) 535
Hpy166II GTNNAC 1 cut(s) 529
Hpy188I TCNGA 6 cut(s) 69, 331, 421, 522, 616, 774
Hpy188III TCNNGA 4 cut(s) 194, 216, 236, 260
Hpy8I GTNNAC 1 cut(s) 529
Hpy99I CGWCG 1 cut(s) 810
HpyAV CCTTC 3 cut(s) 702, 776, 860
HpyCH4III ACNGT 2 cut(s) 379, 401
HpyCH4V TGCA 5 cut(s) 227, 298, 643, 739, 857
HpyF10VI GCNNNNNNNGC 3 cut(s) 143, 278, 502
HpyF3I CTNAG 3 cut(s) 242, 507, 665
Hsp92II CATG 4 cut(s) 458, 472, 561, 760
Kzo9I GATC 4 cut(s) 64, 421, 540, 592
Lsp1109I GCAGC 1 cut(s) 841
MaeI CTAG 2 cut(s) 216, 408
MaeIII GTNAC 1 cut(s) 51
MalI GATC 4 cut(s) 66, 423, 542, 594
MboI GATC 4 cut(s) 64, 421, 540, 592
MboII GAAGA 4 cut(s) 74, 599, 687, 835
MflI RGATCY 2 cut(s) 64, 421
MhlI GDGCHC 1 cut(s) 851
MluCI AATT 4 cut(s) 36, 289, 491, 637
MlyI GAGTC 1 cut(s) 329
MnlI CCTC 8 cut(s) 136, 161, 190, 251, 491, 564, 580, 772
MseI TTAA 5 cut(s) 365, 374, 390, 404, 443
MspR9I CCNGG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 165
MwoI GCNNNNNNNGC 3 cut(s) 143, 278, 502
NcoI CCATGG 2 cut(s) 557, 756
NdeII GATC 4 cut(s) 64, 421, 540, 592
NlaIII CATG 4 cut(s) 458, 472, 561, 760
NlaIV GGNNCC 1 cut(s) 569
NspI RCATGY 1 cut(s) 472
PciI ACATGT 1 cut(s) 468
PcsI WCGNNNNNNNCGW 2 cut(s) 47, 318
PfeI GAWTC 2 cut(s) 212, 314
PkrI GCNGC 1 cut(s) 856
PleI GAGTC 1 cut(s) 329
PpsI GAGTC 1 cut(s) 329
PpuMI RGGWCCY 1 cut(s) 568
PscI ACATGT 1 cut(s) 468
Psp5II RGGWCCY 1 cut(s) 568
Psp6I CCWGG 1 cut(s) 163
PspFI CCCAGC 1 cut(s) 345
PspGI CCWGG 1 cut(s) 163
PspN4I GGNNCC 1 cut(s) 569
PspPI GGNCC 1 cut(s) 568
PspPPI RGGWCCY 1 cut(s) 568
PstI CTGCAG 1 cut(s) 300
PsuI RGATCY 2 cut(s) 64, 421
RsaI GTAC 2 cut(s) 5, 267
RsaNI GTAC 2 cut(s) 4, 266
SaqAI TTAA 5 cut(s) 365, 374, 390, 404, 443
SatI GCNGC 1 cut(s) 855
Sau3AI GATC 4 cut(s) 64, 421, 540, 592
Sau96I GGNCC 1 cut(s) 568
SchI GAGTC 1 cut(s) 329
ScrFI CCNGG 1 cut(s) 165
SduI GDGCHC 1 cut(s) 851
SetI ASST 8 cut(s) 243, 271, 347, 513, 573, 591, 871, 884
SfcI CTRYAG 1 cut(s) 296
SinI GGWCC 1 cut(s) 568
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
Sse9I AATT 4 cut(s) 36, 289, 491, 637
SspMI CTAG 2 cut(s) 216, 408
StyD4I CCNGG 1 cut(s) 163
StyI CCWWGG 2 cut(s) 557, 756
TaaI ACNGT 2 cut(s) 379, 401
TaqI TCGA 1 cut(s) 312
TasI AATT 4 cut(s) 36, 289, 491, 637
TatI WGTACW 1 cut(s) 3
TfiI GAWTC 2 cut(s) 212, 314
Tru1I TTAA 5 cut(s) 365, 374, 390, 404, 443
Tru9I TTAA 5 cut(s) 365, 374, 390, 404, 443
TseI GCWGC 1 cut(s) 854
TspDTI ATGAA 5 cut(s) 302, 443, 588, 813, 879
VpaK11BI GGWCC 1 cut(s) 568
XapI RAATTY 1 cut(s) 289
XbaI TCTAGA 1 cut(s) 215
XceI RCATGY 1 cut(s) 472
XspI CTAG 2 cut(s) 216, 408
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.