Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006500.1

Orthogroup ID

OG0009438

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 2721

Gene Structure 2721 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006500.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 861 bp

gatggacctattcttaaacaagctcagagtcgccccatttctagaaacaacaatgctgatagatccgataaaggaaaggcgaaaaaagctgctatagataagaataggttggaacgatggaaggctactggagttataggactcagtgagtgtaacttgaaggctatacccgaggaagtctggggggattctagaacttctgcaagagttcttgacctcagcaacaatgttattcaagaagtacccgccttgattggctgtatgaattccttgcagaaacttttactcgattcaaacgatatatcggatgactctgttagctgggaagcactaaaatctttaaagtctttaactgttctttctctgaaccaaaaccgtttaactagattgtcattggatctgggctggttgccatcattaaggcaacttcatgttgcgaacaacatgttgtctggcctcccaagtgaattgcgatatctgcctaagcttgaagttctgaaagtcaacaataacaggatcaccaccattcctccatggataggggaccttatttctcttattgaggttgatctttcatcaaatcttctttcagatttgcccgagacatttagcaatttgcataatctaaagtccctgtctctcagtaataatggactgaaatctctcccttcttcgctattcaaaatgtgcctaatgctcacaagacttgacttgcacaacacagaaataaccatggatatccttcgtcagattgagggatgggaaaactttgatgaacgccgtcgcttgaagcaacagaagaaactggattttcgtgttgtgggctctgctacatttgatgaaggtgctgataaaagctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_8 ubiquitin

Protein Analysis

286

Amino Acids

32.08

Weight (kDa)

8.71

Isoelectric Point (pI)

48.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009438)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G30105
fragaria_vesca	FvH4_3g39360 FvH4_3g39360 FvH4_3g39360
malus_domestica	MD03G1062200.v1.1
prunus_persica	Prupe.6G052000_v2.0.a1 Prupe.6G052000_v2.0.a1
pyrus_communis	pycom03g04960
rosa_chinensis	RchiOBHm_Chr5g0070801 RchiOBHm_Chr5g0070821
rosa_laevigata	RLG00000036159
rosa_multiflora	Rmu_sc0002944.1_g000022 Rmu_sc0006500.1_g000001 Rmu_sc0010241.1_g000005
rosa_roxburghii	Rroxscaffold_1G00010350
rosa_rugosa	Rorug05G0408500
rosa_samantha	Rh5AG464000 Rh5BG481800 Rh5CG506300 Rh5CG506500 Rh5DG494700
rosa_wichuraiana	Rw5G043190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	246
AclWI	GGATC	3 cut(s)	57, 405, 524
AcsI	RAATTY	1 cut(s)	265
AfaI	GTAC	1 cut(s)	243
AfiI	CCNNNNNNNGG	1 cut(s)	539
AflIII	ACRYGT	1 cut(s)	444
AgsI	TTSAA	6 cut(s)	160, 236, 294, 491, 682, 790
AluBI	AGCT	5 cut(s)	23, 89, 321, 487, 858
AluI	AGCT	5 cut(s)	23, 89, 321, 487, 858
Alw26I	GTCTC	2 cut(s)	596, 642
AlwI	GGATC	3 cut(s)	57, 405, 524
Ama87I	CYCGRG	2 cut(s)	170, 599
AoxI	GGCC	1 cut(s)	454
ApeKI	GCWGC	1 cut(s)	89
ApoI	RAATTY	1 cut(s)	265
AspS9I	GGNCC	2 cut(s)	5, 544
AsuHPI	GGTGA	1 cut(s)	511
AvaI	CYCGRG	2 cut(s)	170, 599
AvaII	GGWCC	2 cut(s)	5, 544
BanII	GRGCYC	1 cut(s)	827
BbvCI	CCTCAGC	1 cut(s)	218
BbvI	GCAGC	1 cut(s)	76
BccI	CCATC	3 cut(s)	111, 421, 753
BceAI	ACGGC	1 cut(s)	765
BcoDI	GTCTC	2 cut(s)	596, 642
BfaI	CTAG	3 cut(s)	42, 192, 384
BfmI	CTRYAG	1 cut(s)	93
BisI	GCNGC	1 cut(s)	90
BlsI	GCNGC	1 cut(s)	91
Bme18I	GGWCC	2 cut(s)	5, 544
BmeT110I	CYCGRG	2 cut(s)	170, 599
BmgT120I	GGNCC	2 cut(s)	5, 544
BmiI	GGNNCC	1 cut(s)	545
BpmI	CTGGAG	1 cut(s)	150
Bpu10I	CCTNAGC	2 cut(s)	218, 483
BsaJI	CCNNGG	3 cut(s)	171, 533, 732
BsaXI	ACNNNNNCTCC	2 cut(s)	514, 544
Bsc4I	CCNNNNNNNGG	1 cut(s)	539
Bse1I	ACTGG	2 cut(s)	133, 810
BseDI	CCNNGG	3 cut(s)	171, 533, 732
BseGI	GGATG	2 cut(s)	313, 764
BseLI	CCNNNNNNNGG	1 cut(s)	539
BseMII	CTCAG	4 cut(s)	38, 157, 232, 655
BseNI	ACTGG	2 cut(s)	133, 810
BseXI	GCAGC	1 cut(s)	76
BseYI	CCCAGC	1 cut(s)	321
BshFI	GGCC	1 cut(s)	456
BsiHKCI	CYCGRG	2 cut(s)	170, 599
BslFI	GGGAC	2 cut(s)	557, 616
BslI	CCNNNNNNNGG	1 cut(s)	539
BsmAI	GTCTC	2 cut(s)	596, 642
BsmFI	GGGAC	2 cut(s)	557, 616
BsnI	GGCC	1 cut(s)	456
BsoBI	CYCGRG	2 cut(s)	170, 599
Bsp1286I	GDGCHC	1 cut(s)	827
Bsp143I	GATC	4 cut(s)	62, 397, 516, 568
Bsp19I	CCATGG	2 cut(s)	533, 732
BspACI	CCGC	1 cut(s)	246
BspANI	GGCC	1 cut(s)	456
BspCNI	CTCAG	4 cut(s)	37, 156, 231, 654
BspLI	GGNNCC	1 cut(s)	545
BspPI	GGATC	3 cut(s)	57, 405, 524
BsrI	ACTGG	2 cut(s)	133, 810
BssECI	CCNNGG	3 cut(s)	171, 533, 732
BssMI	GATC	4 cut(s)	62, 397, 516, 568
BssT1I	CCWWGG	2 cut(s)	533, 732
Bst4CI	ACNGT	2 cut(s)	355, 377
BstDEI	CTNAG	5 cut(s)	24, 143, 218, 483, 641
BstDSI	CCRYGG	2 cut(s)	533, 732
BstF5I	GGATG	2 cut(s)	313, 764
BstKTI	GATC	4 cut(s)	65, 400, 519, 571
BstMAI	GTCTC	2 cut(s)	596, 642
BstMBI	GATC	4 cut(s)	62, 397, 516, 568
BstMWI	GCNNNNNNNGC	2 cut(s)	86, 478
BstNSI	RCATGY	1 cut(s)	448
BstSFI	CTRYAG	1 cut(s)	93
BstV1I	GCAGC	1 cut(s)	76
BstX2I	RGATCY	2 cut(s)	62, 397
BstYI	RGATCY	2 cut(s)	62, 397
BsuRI	GGCC	1 cut(s)	456
BtgI	CCRYGG	2 cut(s)	533, 732
BtsCI	GGATG	2 cut(s)	313, 764
BtsIMutI	CAGTG	1 cut(s)	151
Cfr13I	GGNCC	2 cut(s)	5, 544
Csp6I	GTAC	1 cut(s)	242
CviAII	CATG	4 cut(s)	431, 445, 534, 733
CviQI	GTAC	1 cut(s)	242
DdeI	CTNAG	5 cut(s)	24, 143, 218, 483, 641
DpnI	GATC	4 cut(s)	64, 399, 518, 570
DpnII	GATC	4 cut(s)	62, 397, 516, 568
DraI	TTTAAA	1 cut(s)	342
Eco130I	CCWWGG	2 cut(s)	533, 732
Eco24I	GRGCYC	1 cut(s)	827
Eco32I	GATATC	2 cut(s)	476, 739
Eco47I	GGWCC	2 cut(s)	5, 544
Eco88I	CYCGRG	2 cut(s)	170, 599
EcoO109I	RGGNCCY	1 cut(s)	544
EcoRI	GAATTC	1 cut(s)	265
EcoRV	GATATC	2 cut(s)	476, 739
EcoT14I	CCWWGG	2 cut(s)	533, 732
EcoT38I	GRGCYC	1 cut(s)	827
ErhI	CCWWGG	2 cut(s)	533, 732
FaeI	CATG	4 cut(s)	434, 448, 537, 736
FaqI	GGGAC	2 cut(s)	557, 616
FatI	CATG	4 cut(s)	430, 444, 533, 732
FauI	CCCGC	1 cut(s)	253
Fnu4HI	GCNGC	1 cut(s)	90
FokI	GGATG	2 cut(s)	320, 771
FriOI	GRGCYC	1 cut(s)	827
Fsp4HI	GCNGC	1 cut(s)	90
FspBI	CTAG	3 cut(s)	42, 192, 384
GluI	GCNGC	1 cut(s)	90
GsaI	CCCAGC	1 cut(s)	325
GsuI	CTGGAG	1 cut(s)	150
HaeIII	GGCC	1 cut(s)	456
Hin1II	CATG	4 cut(s)	434, 448, 537, 736
HincII	GTYRAC	1 cut(s)	505
HindII	GTYRAC	1 cut(s)	505
HindIII	AAGCTT	1 cut(s)	485
HinfI	GANTC	5 cut(s)	28, 141, 188, 290, 311
HphI	GGTGA	1 cut(s)	511
Hpy166II	GTNNAC	1 cut(s)	505
Hpy188I	TCNGA	7 cut(s)	27, 67, 307, 366, 498, 592, 750
Hpy188III	TCNNGA	4 cut(s)	42, 192, 212, 236
Hpy8I	GTNNAC	1 cut(s)	505
Hpy99I	CGWCG	1 cut(s)	786
HpyAV	CCTTC	5 cut(s)	115, 154, 678, 752, 836
HpyCH4III	ACNGT	2 cut(s)	355, 377
HpyCH4V	TGCA	4 cut(s)	203, 274, 619, 715
HpyF10VI	GCNNNNNNNGC	2 cut(s)	86, 478
HpyF3I	CTNAG	5 cut(s)	24, 143, 218, 483, 641
Hsp92II	CATG	4 cut(s)	434, 448, 537, 736
Kzo9I	GATC	4 cut(s)	62, 397, 516, 568
LpnPI	CCDG	9 cut(s)	114, 166, 307, 386, 391, 438, 499, 647, 791
Lsp1109I	GCAGC	1 cut(s)	76
MaeI	CTAG	3 cut(s)	42, 192, 384
MaeIII	GTNAC	1 cut(s)	152
MalI	GATC	4 cut(s)	64, 399, 518, 570
MboI	GATC	4 cut(s)	62, 397, 516, 568
MboII	GAAGA	3 cut(s)	575, 663, 811
MflI	RGATCY	2 cut(s)	62, 397
MhlI	GDGCHC	1 cut(s)	827
MluCI	AATT	3 cut(s)	265, 467, 613
MlyI	GAGTC	3 cut(s)	37, 135, 305
MmeI	TCCRAC	1 cut(s)	90
MnlI	CCTC	6 cut(s)	166, 227, 467, 540, 556, 748
MseI	TTAA	5 cut(s)	15, 341, 350, 380, 419
MwoI	GCNNNNNNNGC	2 cut(s)	86, 478
NcoI	CCATGG	2 cut(s)	533, 732
NdeII	GATC	4 cut(s)	62, 397, 516, 568
NlaIII	CATG	4 cut(s)	434, 448, 537, 736
NlaIV	GGNNCC	1 cut(s)	545
NspI	RCATGY	1 cut(s)	448
PciI	ACATGT	1 cut(s)	444
PcsI	WCGNNNNNNNCGW	1 cut(s)	294
PfeI	GAWTC	2 cut(s)	188, 290
PkrI	GCNGC	1 cut(s)	91
PleI	GAGTC	3 cut(s)	36, 135, 305
PpsI	GAGTC	3 cut(s)	36, 135, 305
PpuMI	RGGWCCY	1 cut(s)	544
PscI	ACATGT	1 cut(s)	444
Psp5II	RGGWCCY	1 cut(s)	544
PspFI	CCCAGC	1 cut(s)	321
PspN4I	GGNNCC	1 cut(s)	545
PspPI	GGNCC	2 cut(s)	5, 544
PspPPI	RGGWCCY	1 cut(s)	544
PsuI	RGATCY	2 cut(s)	62, 397
RsaI	GTAC	1 cut(s)	243
RsaNI	GTAC	1 cut(s)	242
SaqAI	TTAA	5 cut(s)	15, 341, 350, 380, 419
SatI	GCNGC	1 cut(s)	90
Sau3AI	GATC	4 cut(s)	62, 397, 516, 568
Sau96I	GGNCC	2 cut(s)	5, 544
SchI	GAGTC	3 cut(s)	37, 135, 305
SduI	GDGCHC	1 cut(s)	827
SfcI	CTRYAG	1 cut(s)	93
SinI	GGWCC	2 cut(s)	5, 544
Sse9I	AATT	3 cut(s)	265, 467, 613
SsiI	CCGC	1 cut(s)	246
SspMI	CTAG	3 cut(s)	42, 192, 384
StyI	CCWWGG	2 cut(s)	533, 732
TaaI	ACNGT	2 cut(s)	355, 377
TaqI	TCGA	1 cut(s)	288
TasI	AATT	3 cut(s)	265, 467, 613
TfiI	GAWTC	2 cut(s)	188, 290
Tru1I	TTAA	5 cut(s)	15, 341, 350, 380, 419
Tru9I	TTAA	5 cut(s)	15, 341, 350, 380, 419
TscAI	CASTG	1 cut(s)	151
TseI	GCWGC	1 cut(s)	89
TspDTI	ATGAA	5 cut(s)	278, 419, 564, 789, 855
TspRI	CASTG	1 cut(s)	151
VpaK11BI	GGWCC	2 cut(s)	5, 544
XapI	RAATTY	1 cut(s)	265
XbaI	TCTAGA	2 cut(s)	41, 191
XceI	RCATGY	1 cut(s)	448
XspI	CTAG	3 cut(s)	42, 192, 384

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.