Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010241.1

Orthogroup ID

OG0009438

Physical Location & Seq

Genomic Coordinates Reverse (-)

15462 .. 18890

Gene Structure 3429 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010241.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1029 bp

atgaccaccggcctttgcattttgttgccttccttggtgccaaatagactacgagctataggagggaagcttttggtggatgcaatgacgctgagggagtctgagatcactaatggggccaagatcatgctcatggcttctcagggtttgcaccaaggggatggacctattcttaaacaagctcagagtcgccccatttctagagacaacaatgctgatagatccgatgaaggaaaggcgaaaaaagctgctgttgataagaataggttggaacgatggaaggctactggagttataggactcactgagtgtaacttgaaggctattcccgaggaagtctggggggattctagaacttctgcaagagttcttgacctcagcaacaatgttattcaagaagtacctgccttgattggctgtatgaattccttgcagaaacttttactctattcaaatgatatatcggacgactctgttagctgggaagcactaaaatctttaaagtctttaactgttctttctctgaaccaaaaccgtttaactagattgtcattggatctgggctggttgccatcattaaggcaacttcatgttgggaacaacatgttgtctggcctcccaagtgaattgcgatatctgcctaagcttgaagttctgaaagtcaacaataacaggatcaccaccattcctccatggataggggaccttatctctcttattgaggttgatctttcatcgaatcttctctcagatttgcccgagacatttagcaatttgcataacctagagttgtattattccctgtctctcagtaataatgggctgaaatctctcccttcttcgctattcaaaatgtgcctaatgctcacaagacttgacttgcacaacacagaaataaccatggatatccttcgtcagattgagggatgggaaaactttgatgaacgccgtcgcttgaagcaacagaagaaactggattttcgtgttgtgggctctgctgcatttgatgaaggtgctgataaaagctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_8 ubiquitin

Protein Analysis

342

Amino Acids

38.14

Weight (kDa)

7.65

Isoelectric Point (pI)

44.65

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009438)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G30105
fragaria_vesca	FvH4_3g39360 FvH4_3g39360 FvH4_3g39360
malus_domestica	MD03G1062200.v1.1
prunus_persica	Prupe.6G052000_v2.0.a1 Prupe.6G052000_v2.0.a1
pyrus_communis	pycom03g04960
rosa_chinensis	RchiOBHm_Chr5g0070801 RchiOBHm_Chr5g0070821
rosa_laevigata	RLG00000036159
rosa_multiflora	Rmu_sc0002944.1_g000022 Rmu_sc0006500.1_g000001 Rmu_sc0010241.1_g000005
rosa_roxburghii	Rroxscaffold_1G00010350
rosa_rugosa	Rorug05G0408500
rosa_samantha	Rh5AG464000 Rh5BG481800 Rh5CG506300 Rh5CG506500 Rh5DG494700
rosa_wichuraiana	Rw5G043190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	412
AccB1I	GGYRCC	1 cut(s)	37
AclWI	GGATC	3 cut(s)	216, 564, 683
AcsI	RAATTY	1 cut(s)	424
AdeI	CACNNNGTG	1 cut(s)	309
AfaI	GTAC	1 cut(s)	402
AfiI	CCNNNNNNNGG	1 cut(s)	698
AflIII	ACRYGT	1 cut(s)	603
AgsI	TTSAA	6 cut(s)	319, 395, 453, 650, 850, 958
AluBI	AGCT	7 cut(s)	56, 70, 182, 248, 480, 646, 1026
AluI	AGCT	7 cut(s)	56, 70, 182, 248, 480, 646, 1026
Alw26I	GTCTC	3 cut(s)	198, 755, 810
AlwI	GGATC	3 cut(s)	216, 564, 683
Ama87I	CYCGRG	2 cut(s)	329, 758
AoxI	GGCC	3 cut(s)	10, 117, 613
ApeKI	GCWGC	2 cut(s)	248, 998
ApoI	RAATTY	1 cut(s)	424
AspS9I	GGNCC	3 cut(s)	117, 164, 703
AsuHPI	GGTGA	1 cut(s)	670
AvaI	CYCGRG	2 cut(s)	329, 758
AvaII	GGWCC	2 cut(s)	164, 703
BanI	GGYRCC	1 cut(s)	37
BanII	GRGCYC	1 cut(s)	995
BbvCI	CCTCAGC	2 cut(s)	92, 377
BbvI	GCAGC	2 cut(s)	235, 985
BccI	CCATC	4 cut(s)	155, 270, 580, 921
BceAI	ACGGC	1 cut(s)	933
BcoDI	GTCTC	3 cut(s)	198, 755, 810
BfaI	CTAG	4 cut(s)	201, 351, 543, 785
BfmI	CTRYAG	1 cut(s)	57
BfuAI	ACCTGC	1 cut(s)	412
BisI	GCNGC	2 cut(s)	249, 999
BlsI	GCNGC	2 cut(s)	250, 1000
Bme18I	GGWCC	2 cut(s)	164, 703
BmeT110I	CYCGRG	2 cut(s)	329, 758
BmgT120I	GGNCC	3 cut(s)	117, 164, 703
BmiI	GGNNCC	3 cut(s)	39, 118, 704
BmsI	GCATC	1 cut(s)	70
BpmI	CTGGAG	1 cut(s)	309
Bpu10I	CCTNAGC	3 cut(s)	92, 377, 642
BsaJI	CCNNGG	5 cut(s)	33, 154, 330, 692, 900
BsaXI	ACNNNNNCTCC	2 cut(s)	673, 703
Bsc4I	CCNNNNNNNGG	1 cut(s)	698
Bse118I	RCCGGY	1 cut(s)	8
Bse1I	ACTGG	2 cut(s)	292, 978
Bse3DI	GCAATG	1 cut(s)	90
BseDI	CCNNGG	5 cut(s)	33, 154, 330, 692, 900
BseGI	GGATG	3 cut(s)	85, 166, 932
BseLI	CCNNNNNNNGG	1 cut(s)	698
BseMI	GCAATG	1 cut(s)	90
BseMII	CTCAG	8 cut(s)	83, 93, 155, 197, 297, 391, 762, 823
BseNI	ACTGG	2 cut(s)	292, 978
BseXI	GCAGC	2 cut(s)	235, 985
BseYI	CCCAGC	1 cut(s)	480
BshFI	GGCC	3 cut(s)	12, 119, 615
BshNI	GGYRCC	1 cut(s)	37
BsiHKCI	CYCGRG	2 cut(s)	329, 758
BsiSI	CCGG	1 cut(s)	9
BslFI	GGGAC	1 cut(s)	716
BslI	CCNNNNNNNGG	1 cut(s)	698
BsmAI	GTCTC	3 cut(s)	198, 755, 810
BsmFI	GGGAC	1 cut(s)	716
BsnI	GGCC	3 cut(s)	12, 119, 615
BsoBI	CYCGRG	2 cut(s)	329, 758
Bsp1286I	GDGCHC	1 cut(s)	995
Bsp143I	GATC	6 cut(s)	105, 123, 221, 556, 675, 727
Bsp19I	CCATGG	2 cut(s)	692, 900
BspANI	GGCC	3 cut(s)	12, 119, 615
BspCNI	CTCAG	8 cut(s)	84, 94, 154, 196, 298, 390, 761, 822
BspLI	GGNNCC	3 cut(s)	39, 118, 704
BspMI	ACCTGC	1 cut(s)	412
BspPI	GGATC	3 cut(s)	216, 564, 683
BspT107I	GGYRCC	1 cut(s)	37
BsrDI	GCAATG	1 cut(s)	90
BsrFI	RCCGGY	1 cut(s)	8
BsrI	ACTGG	2 cut(s)	292, 978
BssAI	RCCGGY	1 cut(s)	8
BssECI	CCNNGG	5 cut(s)	33, 154, 330, 692, 900
BssMI	GATC	6 cut(s)	105, 123, 221, 556, 675, 727
BssT1I	CCWWGG	4 cut(s)	33, 154, 692, 900
Bst4CI	ACNGT	2 cut(s)	514, 536
BstDEI	CTNAG	9 cut(s)	92, 102, 141, 183, 306, 377, 642, 748, 809
BstDSI	CCRYGG	2 cut(s)	692, 900
BstF5I	GGATG	3 cut(s)	85, 166, 932
BstKTI	GATC	6 cut(s)	108, 126, 224, 559, 678, 730
BstMAI	GTCTC	3 cut(s)	198, 755, 810
BstMBI	GATC	6 cut(s)	105, 123, 221, 556, 675, 727
BstMWI	GCNNNNNNNGC	2 cut(s)	245, 637
BstNSI	RCATGY	1 cut(s)	607
BstSFI	CTRYAG	1 cut(s)	57
BstV1I	GCAGC	2 cut(s)	235, 985
BstX2I	RGATCY	2 cut(s)	221, 556
BstXI	CCANNNNNNTGG	1 cut(s)	161
BstYI	RGATCY	2 cut(s)	221, 556
BsuRI	GGCC	3 cut(s)	12, 119, 615
BtgI	CCRYGG	2 cut(s)	692, 900
BtsCI	GGATG	3 cut(s)	85, 166, 932
BtsIMutI	CAGTG	1 cut(s)	303
BveI	ACCTGC	1 cut(s)	412
Cfr10I	RCCGGY	1 cut(s)	8
Cfr13I	GGNCC	3 cut(s)	117, 164, 703
CseI	GACGC	1 cut(s)	97
Csp6I	GTAC	1 cut(s)	401
CviAII	CATG	6 cut(s)	127, 133, 590, 604, 693, 901
CviQI	GTAC	1 cut(s)	401
DdeI	CTNAG	9 cut(s)	92, 102, 141, 183, 306, 377, 642, 748, 809
DpnI	GATC	6 cut(s)	107, 125, 223, 558, 677, 729
DpnII	GATC	6 cut(s)	105, 123, 221, 556, 675, 727
DraI	TTTAAA	1 cut(s)	501
DraIII	CACNNNGTG	1 cut(s)	309
Eco130I	CCWWGG	4 cut(s)	33, 154, 692, 900
Eco24I	GRGCYC	1 cut(s)	995
Eco32I	GATATC	2 cut(s)	635, 907
Eco47I	GGWCC	2 cut(s)	164, 703
Eco88I	CYCGRG	2 cut(s)	329, 758
EcoO109I	RGGNCCY	1 cut(s)	703
EcoRI	GAATTC	1 cut(s)	424
EcoRV	GATATC	2 cut(s)	635, 907
EcoT14I	CCWWGG	4 cut(s)	33, 154, 692, 900
EcoT38I	GRGCYC	1 cut(s)	995
ErhI	CCWWGG	4 cut(s)	33, 154, 692, 900
FaeI	CATG	6 cut(s)	130, 136, 593, 607, 696, 904
FaqI	GGGAC	1 cut(s)	716
FatI	CATG	6 cut(s)	126, 132, 589, 603, 692, 900
Fnu4HI	GCNGC	2 cut(s)	249, 999
FokI	GGATG	3 cut(s)	92, 173, 939
FriOI	GRGCYC	1 cut(s)	995
Fsp4HI	GCNGC	2 cut(s)	249, 999
FspBI	CTAG	4 cut(s)	201, 351, 543, 785
GluI	GCNGC	2 cut(s)	249, 999
GsaI	CCCAGC	1 cut(s)	484
GsuI	CTGGAG	1 cut(s)	309
HaeIII	GGCC	3 cut(s)	12, 119, 615
HapII	CCGG	1 cut(s)	9
HgaI	GACGC	1 cut(s)	97
Hin1II	CATG	6 cut(s)	130, 136, 593, 607, 696, 904
HincII	GTYRAC	1 cut(s)	664
HindII	GTYRAC	1 cut(s)	664
HindIII	AAGCTT	2 cut(s)	68, 644
HinfI	GANTC	6 cut(s)	98, 187, 300, 347, 470, 739
HpaII	CCGG	1 cut(s)	9
HphI	GGTGA	1 cut(s)	670
Hpy166II	GTNNAC	1 cut(s)	664
Hpy188I	TCNGA	8 cut(s)	103, 186, 226, 466, 525, 657, 751, 918
Hpy188III	TCNNGA	5 cut(s)	201, 329, 351, 371, 395
Hpy8I	GTNNAC	1 cut(s)	664
Hpy99I	CGWCG	1 cut(s)	954
HpyAV	CCTTC	7 cut(s)	39, 224, 274, 313, 846, 920, 1004
HpyCH4III	ACNGT	2 cut(s)	514, 536
HpyCH4V	TGCA	8 cut(s)	18, 83, 151, 362, 433, 778, 883, 1001
HpyF10VI	GCNNNNNNNGC	2 cut(s)	245, 637
HpyF3I	CTNAG	9 cut(s)	92, 102, 141, 183, 306, 377, 642, 748, 809
Hsp92II	CATG	6 cut(s)	130, 136, 593, 607, 696, 904
Kzo9I	GATC	6 cut(s)	105, 123, 221, 556, 675, 727
Lsp1109I	GCAGC	2 cut(s)	235, 985
LweI	GCATC	1 cut(s)	70
MaeI	CTAG	4 cut(s)	201, 351, 543, 785
MaeIII	GTNAC	1 cut(s)	311
MalI	GATC	6 cut(s)	107, 125, 223, 558, 677, 729
MboI	GATC	6 cut(s)	105, 123, 221, 556, 675, 727
MboII	GAAGA	3 cut(s)	734, 831, 979
MflI	RGATCY	2 cut(s)	221, 556
MhlI	GDGCHC	1 cut(s)	995
MluCI	AATT	3 cut(s)	424, 626, 772
MlyI	GAGTC	4 cut(s)	107, 196, 294, 464
MmeI	TCCRAC	1 cut(s)	249
MnlI	CCTC	8 cut(s)	56, 87, 325, 386, 626, 699, 715, 916
MseI	TTAA	5 cut(s)	174, 500, 509, 539, 578
MslI	CAYNNNNRTG	1 cut(s)	131
MspI	CCGG	1 cut(s)	9
MwoI	GCNNNNNNNGC	2 cut(s)	245, 637
NcoI	CCATGG	2 cut(s)	692, 900
NdeII	GATC	6 cut(s)	105, 123, 221, 556, 675, 727
NlaIII	CATG	6 cut(s)	130, 136, 593, 607, 696, 904
NlaIV	GGNNCC	3 cut(s)	39, 118, 704
NspI	RCATGY	1 cut(s)	607
PciI	ACATGT	1 cut(s)	603
PfeI	GAWTC	2 cut(s)	347, 739
PkrI	GCNGC	2 cut(s)	250, 1000
PleI	GAGTC	4 cut(s)	106, 195, 294, 464
PpsI	GAGTC	4 cut(s)	106, 195, 294, 464
PpuMI	RGGWCCY	1 cut(s)	703
PscI	ACATGT	1 cut(s)	603
Psp5II	RGGWCCY	1 cut(s)	703
PspFI	CCCAGC	1 cut(s)	480
PspN4I	GGNNCC	3 cut(s)	39, 118, 704
PspPI	GGNCC	3 cut(s)	117, 164, 703
PspPPI	RGGWCCY	1 cut(s)	703
PsuI	RGATCY	2 cut(s)	221, 556
RsaI	GTAC	1 cut(s)	402
RsaNI	GTAC	1 cut(s)	401
RseI	CAYNNNNRTG	1 cut(s)	131
SaqAI	TTAA	5 cut(s)	174, 500, 509, 539, 578
SatI	GCNGC	2 cut(s)	249, 999
Sau3AI	GATC	6 cut(s)	105, 123, 221, 556, 675, 727
Sau96I	GGNCC	3 cut(s)	117, 164, 703
SchI	GAGTC	4 cut(s)	107, 196, 294, 464
SduI	GDGCHC	1 cut(s)	995
SfaNI	GCATC	1 cut(s)	70
SfcI	CTRYAG	1 cut(s)	57
SinI	GGWCC	2 cut(s)	164, 703
SmiMI	CAYNNNNRTG	1 cut(s)	131
Sse9I	AATT	3 cut(s)	424, 626, 772
SspMI	CTAG	4 cut(s)	201, 351, 543, 785
StyI	CCWWGG	4 cut(s)	33, 154, 692, 900
TaaI	ACNGT	2 cut(s)	514, 536
TaqI	TCGA	1 cut(s)	737
TasI	AATT	3 cut(s)	424, 626, 772
TfiI	GAWTC	2 cut(s)	347, 739
Tru1I	TTAA	5 cut(s)	174, 500, 509, 539, 578
Tru9I	TTAA	5 cut(s)	174, 500, 509, 539, 578
TscAI	CASTG	1 cut(s)	310
TseI	GCWGC	2 cut(s)	248, 998
TspDTI	ATGAA	6 cut(s)	243, 437, 578, 723, 957, 1023
TspRI	CASTG	1 cut(s)	310
VpaK11BI	GGWCC	2 cut(s)	164, 703
XapI	RAATTY	1 cut(s)	424
XbaI	TCTAGA	2 cut(s)	200, 350
XceI	RCATGY	1 cut(s)	607
XspI	CTAG	4 cut(s)	201, 351, 543, 785

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.