Rmu_sc0003168.1_g000020

Maf-like protein DDB_G0281937 isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003168.1
OG0002073
Physical Location & Seq
Forward (+)
104900 .. 106451
1552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003168.1_g000020.1.cds

Sequence Viewer

Length: 354 bp
atggaaaccaattcttctccttcgttcaagataatcttgggctcatcttcgaatgctcgccggaaaattttggctgaaatgggatatgaattcacactcatgactgcagacattgacgaaaaaagcatccgaaaggagaaaccggaggagttggttatggttcttgctcaggcaaaggctgatgcaatcatatcaaaaatacaaactacccatagtaaagagaaggatgctgaacctgaaccgacaattgtaattgcggcagatacagcagaagccatccggcctaagctcccagttgatgactacgtaaaggatgctgaaccaacgctattaattacctctgatcaagtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Maf

Protein Analysis

117

Amino Acids

12.89

Weight (kDa)

4.81

Isoelectric Point (pI)

29.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 257
AcsI RAATTY 2 cut(s) 66, 89
AgsI TTSAA 1 cut(s) 28
AluBI AGCT 1 cut(s) 289
AluI AGCT 1 cut(s) 289
AoxI GGCC 1 cut(s) 281
ApoI RAATTY 2 cut(s) 66, 89
AseI ATTAAT 1 cut(s) 332
AsuII TTCGAA 1 cut(s) 50
BanII GRGCYC 1 cut(s) 44
BccI CCATC 1 cut(s) 284
BclI TGATCA 1 cut(s) 343
BfmI CTRYAG 1 cut(s) 105
BisI GCNGC 1 cut(s) 258
BlsI GCNGC 1 cut(s) 259
BmrI ACTGGG 1 cut(s) 287
BmsI GCATC 4 cut(s) 135, 172, 217, 304
BmuI ACTGGG 1 cut(s) 287
Bpu10I CCTNAGC 2 cut(s) 168, 285
Bpu14I TTCGAA 1 cut(s) 50
BsaAI YACGTR 1 cut(s) 307
BsaWI WCCGGW 1 cut(s) 142
Bse1I ACTGG 1 cut(s) 293
BseGI GGATG 4 cut(s) 126, 232, 276, 319
BseMII CTCAG 1 cut(s) 182
BseNI ACTGG 1 cut(s) 293
BseRI GAGGAG 1 cut(s) 161
BshFI GGCC 1 cut(s) 283
BsiSI CCGG 3 cut(s) 61, 143, 280
BsmI GAATGC 1 cut(s) 58
BsnI GGCC 1 cut(s) 283
Bsp119I TTCGAA 1 cut(s) 50
Bsp1286I GDGCHC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 343
BspACI CCGC 1 cut(s) 257
BspANI GGCC 1 cut(s) 283
BspCNI CTCAG 1 cut(s) 181
BspHI TCATGA 1 cut(s) 99
BspMAI CTGCAG 1 cut(s) 109
BspT104I TTCGAA 1 cut(s) 50
BsrI ACTGG 1 cut(s) 293
BssMI GATC 1 cut(s) 343
BstBAI YACGTR 1 cut(s) 307
BstBI TTCGAA 1 cut(s) 50
BstC8I GCNNGC 1 cut(s) 58
BstDEI CTNAG 2 cut(s) 168, 285
BstF5I GGATG 4 cut(s) 126, 232, 276, 319
BstKTI GATC 1 cut(s) 346
BstMBI GATC 1 cut(s) 343
BstMWI GCNNNNNNNGC 1 cut(s) 266
BstSFI CTRYAG 1 cut(s) 105
BstSNI TACGTA 1 cut(s) 307
BsuRI GGCC 1 cut(s) 283
BtsCI GGATG 4 cut(s) 126, 232, 276, 319
Cac8I GCNNGC 1 cut(s) 58
CciI TCATGA 1 cut(s) 99
CviAII CATG 1 cut(s) 100
CviJI RGCY 6 cut(s) 42, 74, 179, 275, 283, 289
CviKI_1 RGCY 6 cut(s) 42, 74, 179, 275, 283, 289
DdeI CTNAG 2 cut(s) 168, 285
DpnI GATC 1 cut(s) 345
DpnII GATC 1 cut(s) 343
Eco105I TACGTA 1 cut(s) 307
Eco24I GRGCYC 1 cut(s) 44
EcoRI GAATTC 1 cut(s) 89
EcoT38I GRGCYC 1 cut(s) 44
FaeI CATG 1 cut(s) 103
FaiI YATR 6 cut(s) 87, 101, 158, 191, 213, 352
FalI AAGNNNNNCTT 2 cut(s) 20, 52
FatI CATG 1 cut(s) 99
FbaI TGATCA 1 cut(s) 343
Fnu4HI GCNGC 1 cut(s) 258
FokI GGATG 4 cut(s) 113, 239, 263, 326
FriOI GRGCYC 1 cut(s) 44
Fsp4HI GCNGC 1 cut(s) 258
GluI GCNGC 1 cut(s) 258
HaeIII GGCC 1 cut(s) 283
HapII CCGG 3 cut(s) 61, 143, 280
Hin1II CATG 1 cut(s) 103
HpaII CCGG 3 cut(s) 61, 143, 280
Hpy188I TCNGA 2 cut(s) 131, 343
Hpy188III TCNNGA 2 cut(s) 28, 100
HpyAV CCTTC 2 cut(s) 30, 217
HpyCH4IV ACGT 1 cut(s) 306
HpyCH4V TGCA 2 cut(s) 107, 185
HpyF10VI GCNNNNNNNGC 1 cut(s) 266
HpyF3I CTNAG 2 cut(s) 168, 285
HpySE526I ACGT 1 cut(s) 306
Hsp92II CATG 1 cut(s) 103
Ksp22I TGATCA 1 cut(s) 343
Kzo9I GATC 1 cut(s) 343
LmnI GCTCC 1 cut(s) 294
LpnPI CCDG 6 cut(s) 74, 155, 156, 249, 293, 306
LweI GCATC 4 cut(s) 135, 172, 217, 304
MaeII ACGT 1 cut(s) 306
MalI GATC 1 cut(s) 345
MboI GATC 1 cut(s) 343
MboII GAAGA 2 cut(s) 6, 39
MfeI CAATTG 1 cut(s) 246
MhlI GDGCHC 1 cut(s) 44
MluCI AATT 6 cut(s) 10, 66, 89, 246, 252, 333
MnlI CCTC 2 cut(s) 139, 349
MseI TTAA 1 cut(s) 332
MslI CAYNNNNRTG 1 cut(s) 98
MspI CCGG 3 cut(s) 61, 143, 280
MunI CAATTG 1 cut(s) 246
Mva1269I GAATGC 1 cut(s) 58
MwoI GCNNNNNNNGC 1 cut(s) 266
NdeII GATC 1 cut(s) 343
NlaIII CATG 1 cut(s) 103
NspV TTCGAA 1 cut(s) 50
PagI TCATGA 1 cut(s) 99
PctI GAATGC 1 cut(s) 58
PkrI GCNGC 1 cut(s) 259
Ppu21I YACGTR 1 cut(s) 307
PshBI ATTAAT 1 cut(s) 332
PstI CTGCAG 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 98
SaqAI TTAA 1 cut(s) 332
SatI GCNGC 1 cut(s) 258
Sau3AI GATC 1 cut(s) 343
SduI GDGCHC 1 cut(s) 44
SetI ASST 4 cut(s) 238, 291, 309, 341
SfaNI GCATC 4 cut(s) 135, 172, 217, 304
SfcI CTRYAG 1 cut(s) 105
SfuI TTCGAA 1 cut(s) 50
SmiMI CAYNNNNRTG 1 cut(s) 98
SnaBI TACGTA 1 cut(s) 307
Sse9I AATT 6 cut(s) 10, 66, 89, 246, 252, 333
SsiI CCGC 1 cut(s) 257
TaiI ACGT 1 cut(s) 309
TaqI TCGA 1 cut(s) 50
TasI AATT 6 cut(s) 10, 66, 89, 246, 252, 333
TauI GCSGC 1 cut(s) 260
Tru1I TTAA 1 cut(s) 332
Tru9I TTAA 1 cut(s) 332
TspDTI ATGAA 1 cut(s) 102
VspI ATTAAT 1 cut(s) 332
XapI RAATTY 2 cut(s) 66, 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.