Rh6CG429500

Maf-like protein DDB_G0281937 isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0002073
Physical Location & Seq
Forward (+)
61050674 .. 61053635
2962 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG429500.1

Sequence Viewer

Length: 546 bp
ATGGGATATGAATTCACACTCATGACTGCAGACATTGACGAAAAAAGCATCCGAAAGGAGAAACCGGAGGAGTTGGTTATGGTTCTTGCTCAGGCTAAGGCTGATGCAATCATATCAAAAATACAAACTACCCATAGTAAAGAGAAGGATGCTGAACCTGAACCAACAATTGTAATTGCGGCAGATACAGTGGTAGTCTATGAAGGTGCTGTCAGGGAAAAACCATCCAGCAAGGAAGAAGCACGGCAATTTTTGAAAGACTATTCTGGAGGACATGCAGCAACAGTGGGATCTGTGCTTGTTACAAACCTTAAAACAGGATTCAGTAAAGGAGAATGGGACCGAGTGGAGATCTATTTCCATGAAATACCAGATGAAGCCATTGAGAAGCTGATTGAGGAAGGGACGGTGCTCAAAGTTGCCGGGGGACTGATAATAGAGCATCCTCTGATTCTTCCCTTTGTCAAGGAAGTGGTAGGGACTACTGATAGTGTGATGGGACTTCCAAAAGATATAACGGAGAGACTTCTTAAAGAAGCTCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Maf

Protein Analysis

181

Amino Acids

19.95

Weight (kDa)

4.9

Isoelectric Point (pI)

23.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Maf PF02545 2 - 179 3.5e-36 Maf-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 179
AclWI GGATC 1 cut(s) 298
AcsI RAATTY 1 cut(s) 11
AgsI TTSAA 1 cut(s) 256
AluBI AGCT 2 cut(s) 391, 539
AluI AGCT 2 cut(s) 391, 539
Alw21I GWGCWC 1 cut(s) 414
Alw26I GTCTC 1 cut(s) 517
AlwI GGATC 1 cut(s) 298
ApeKI GCWGC 1 cut(s) 278
ApoI RAATTY 1 cut(s) 11
AspS9I GGNCC 1 cut(s) 340
AsuC2I CCSGG 1 cut(s) 424
AvaII GGWCC 1 cut(s) 340
BaeI ACNNNNGTAYC 2 cut(s) 177, 210
Bbv12I GWGCWC 1 cut(s) 414
BbvI GCAGC 1 cut(s) 290
BccI CCATC 2 cut(s) 232, 490
BceAI ACGGC 1 cut(s) 260
BcnI CCSGG 1 cut(s) 424
BcoDI GTCTC 1 cut(s) 517
BfmI CTRYAG 2 cut(s) 27, 542
BglII AGATCT 1 cut(s) 351
BisI GCNGC 2 cut(s) 180, 279
BlsI GCNGC 2 cut(s) 181, 280
Bme1390I CCNGG 1 cut(s) 424
Bme18I GGWCC 1 cut(s) 340
BmgT120I GGNCC 1 cut(s) 340
BmiI GGNNCC 1 cut(s) 341
BmrFI CCNGG 1 cut(s) 424
BmsI GCATC 4 cut(s) 57, 94, 139, 451
BpmI CTGGAG 1 cut(s) 288
Bpu10I CCTNAGC 2 cut(s) 90, 96
BpuMI CCSGG 1 cut(s) 424
BsaJI CCNNGG 1 cut(s) 423
BsaWI WCCGGW 1 cut(s) 64
BseDI CCNNGG 1 cut(s) 423
BseGI GGATG 4 cut(s) 48, 154, 224, 442
BseMII CTCAG 1 cut(s) 104
BseRI GAGGAG 1 cut(s) 83
BseXI GCAGC 1 cut(s) 290
BsiHKAI GWGCWC 1 cut(s) 414
BsiSI CCGG 2 cut(s) 65, 423
BslFI GGGAC 5 cut(s) 353, 418, 441, 493, 513
BsmAI GTCTC 1 cut(s) 517
BsmFI GGGAC 5 cut(s) 353, 418, 441, 493, 513
Bsp1286I GDGCHC 1 cut(s) 414
Bsp143I GATC 2 cut(s) 290, 351
BspACI CCGC 1 cut(s) 179
BspCNI CTCAG 1 cut(s) 103
BspHI TCATGA 1 cut(s) 21
BspLI GGNNCC 1 cut(s) 341
BspMAI CTGCAG 1 cut(s) 31
BspPI GGATC 1 cut(s) 298
BssECI CCNNGG 1 cut(s) 423
BssMI GATC 2 cut(s) 290, 351
Bst4CI ACNGT 3 cut(s) 190, 286, 409
BstDEI CTNAG 2 cut(s) 90, 96
BstF5I GGATG 4 cut(s) 48, 154, 224, 442
BstKTI GATC 2 cut(s) 293, 354
BstMAI GTCTC 1 cut(s) 517
BstMBI GATC 2 cut(s) 290, 351
BstNSI RCATGY 1 cut(s) 278
BstSCI CCNGG 1 cut(s) 422
BstSFI CTRYAG 2 cut(s) 27, 542
BstV1I GCAGC 1 cut(s) 290
BstX2I RGATCY 2 cut(s) 290, 351
BstYI RGATCY 2 cut(s) 290, 351
BtsCI GGATG 4 cut(s) 48, 154, 224, 442
BtsIMutI CAGTG 2 cut(s) 195, 291
CciI TCATGA 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 340
CviAII CATG 3 cut(s) 22, 275, 362
CviJI RGCY 5 cut(s) 95, 101, 380, 391, 539
CviKI_1 RGCY 5 cut(s) 95, 101, 380, 391, 539
DdeI CTNAG 2 cut(s) 90, 96
DpnI GATC 2 cut(s) 292, 353
DpnII GATC 2 cut(s) 290, 351
Eco47I GGWCC 1 cut(s) 340
EcoRI GAATTC 1 cut(s) 11
FaeI CATG 3 cut(s) 25, 278, 365
FaiI YATR 9 cut(s) 9, 23, 80, 113, 135, 201, 276, 363, 515
FaqI GGGAC 5 cut(s) 353, 418, 441, 493, 513
FatI CATG 3 cut(s) 21, 274, 361
Fnu4HI GCNGC 2 cut(s) 180, 279
FokI GGATG 4 cut(s) 35, 161, 211, 429
Fsp4HI GCNGC 2 cut(s) 180, 279
GluI GCNGC 2 cut(s) 180, 279
GsuI CTGGAG 1 cut(s) 288
HapII CCGG 2 cut(s) 65, 423
Hin1II CATG 3 cut(s) 25, 278, 365
HinfI GANTC 2 cut(s) 321, 451
HpaII CCGG 2 cut(s) 65, 423
Hpy188I TCNGA 2 cut(s) 53, 450
Hpy188III TCNNGA 2 cut(s) 22, 267
HpyAV CCTTC 3 cut(s) 139, 197, 395
HpyCH4III ACNGT 3 cut(s) 190, 286, 409
HpyCH4V TGCA 3 cut(s) 29, 107, 278
HpyF3I CTNAG 2 cut(s) 90, 96
Hsp92II CATG 3 cut(s) 25, 278, 365
Kzo9I GATC 2 cut(s) 290, 351
LpnPI CCDG 9 cut(s) 77, 78, 171, 199, 241, 252, 303, 384, 436
Lsp1109I GCAGC 1 cut(s) 290
LweI GCATC 4 cut(s) 57, 94, 139, 451
MaeIII GTNAC 1 cut(s) 301
MalI GATC 2 cut(s) 292, 353
MboI GATC 2 cut(s) 290, 351
MboII GAAGA 2 cut(s) 248, 446
MfeI CAATTG 1 cut(s) 168
MflI RGATCY 2 cut(s) 290, 351
MhlI GDGCHC 1 cut(s) 414
MluCI AATT 4 cut(s) 11, 168, 174, 248
MnlI CCTC 4 cut(s) 61, 263, 391, 456
MseI TTAA 2 cut(s) 312, 531
MslI CAYNNNNRTG 1 cut(s) 20
MspI CCGG 2 cut(s) 65, 423
MspR9I CCNGG 1 cut(s) 424
MunI CAATTG 1 cut(s) 168
NciI CCSGG 1 cut(s) 424
NdeII GATC 2 cut(s) 290, 351
NlaIII CATG 3 cut(s) 25, 278, 365
NlaIV GGNNCC 1 cut(s) 341
NspI RCATGY 1 cut(s) 278
PagI TCATGA 1 cut(s) 21
PfeI GAWTC 2 cut(s) 321, 451
PkrI GCNGC 2 cut(s) 181, 280
PspN4I GGNNCC 1 cut(s) 341
PspPI GGNCC 1 cut(s) 340
PstI CTGCAG 1 cut(s) 31
PsuI RGATCY 2 cut(s) 290, 351
RseI CAYNNNNRTG 1 cut(s) 20
SaqAI TTAA 2 cut(s) 312, 531
SatI GCNGC 2 cut(s) 180, 279
Sau3AI GATC 2 cut(s) 290, 351
Sau96I GGNCC 1 cut(s) 340
ScrFI CCNGG 1 cut(s) 424
SduI GDGCHC 1 cut(s) 414
SetI ASST 5 cut(s) 160, 208, 312, 393, 541
SfaNI GCATC 4 cut(s) 57, 94, 139, 451
SfcI CTRYAG 2 cut(s) 27, 542
SinI GGWCC 1 cut(s) 340
SmiMI CAYNNNNRTG 1 cut(s) 20
Sse9I AATT 4 cut(s) 11, 168, 174, 248
SsiI CCGC 1 cut(s) 179
StyD4I CCNGG 1 cut(s) 422
TaaI ACNGT 3 cut(s) 190, 286, 409
TaqII GACCGA 1 cut(s) 357
TasI AATT 4 cut(s) 11, 168, 174, 248
TauI GCSGC 1 cut(s) 182
TfiI GAWTC 2 cut(s) 321, 451
Tru1I TTAA 2 cut(s) 312, 531
Tru9I TTAA 2 cut(s) 312, 531
TscAI CASTG 2 cut(s) 195, 291
TseI GCWGC 1 cut(s) 278
TspDTI ATGAA 4 cut(s) 24, 216, 378, 390
TspGWI ACGGA 1 cut(s) 533
TspRI CASTG 2 cut(s) 195, 291
VpaK11BI GGWCC 1 cut(s) 340
XapI RAATTY 1 cut(s) 11
XceI RCATGY 1 cut(s) 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.