Rmu_sc0003454.1_g000019

tRNA(His) guanylyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003454.1
Physical Location & Seq
Forward (+)
73700 .. 74639
940 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003454.1_g000019.1.cds

Sequence Viewer

Length: 501 bp
atggcaaacagcaagtacgagtatgtcaagtcatacgaagttgaagatgagatcttcttgcctaatttgattgttgttcgaattgatggctgtgattttcgaaggtttgcagaaatgcatgagtttgagaaaccaaatgatgaggtagcattgaatttgatgaattcatgtgcagtttctgtgtcggaggagtttccagacatcgttttttcatatggatttagtgacgagtacagcaaagtagagtctattatagtatctttcttcagctcagtatatgtaattaaatggagagaattcttccctcataaggagctaagataccccccctcatttcttgcaaaggttatatgctgtggtgcaatagaagtccttcagtcttatcttttgtggagacaaaatgattgtcatacaaataacctgtgtaatacttgcctatgggagctaataattagaggaatagaggtggaaagactgaaagcgaagcactggagttactag

Protein Analysis

166

Amino Acids

19.61

Weight (kDa)

5.03

Isoelectric Point (pI)

43.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 154, 163, 296
AcuI CTGAAG 2 cut(s) 250, 359
AfaI GTAC 2 cut(s) 17, 233
AfiI CCNNNNNNNGG 1 cut(s) 310
AgsI TTSAA 2 cut(s) 44, 154
AluBI AGCT 3 cut(s) 270, 316, 445
AluI AGCT 3 cut(s) 270, 316, 445
Alw26I GTCTC 1 cut(s) 388
AlwNI CAGNNNCTG 1 cut(s) 179
ApoI RAATTY 3 cut(s) 154, 163, 296
ArsI GACNNNNNNTTYG 2 cut(s) 391, 423
Asp700I GAANNNNTTC 1 cut(s) 372
AsuII TTCGAA 2 cut(s) 79, 100
BccI CCATC 1 cut(s) 80
BcoDI GTCTC 1 cut(s) 388
BfaI CTAG 1 cut(s) 499
BglII AGATCT 1 cut(s) 51
Bpu14I TTCGAA 2 cut(s) 79, 100
Bsc4I CCNNNNNNNGG 1 cut(s) 310
Bse1I ACTGG 1 cut(s) 494
BseLI CCNNNNNNNGG 1 cut(s) 310
BseMII CTCAG 1 cut(s) 285
BseNI ACTGG 1 cut(s) 494
BseRI GAGGAG 1 cut(s) 203
BsgI GTGCAG 1 cut(s) 192
BslI CCNNNNNNNGG 1 cut(s) 310
BsmAI GTCTC 1 cut(s) 388
Bsp119I TTCGAA 2 cut(s) 79, 100
Bsp143I GATC 1 cut(s) 51
BspCNI CTCAG 1 cut(s) 284
BspT104I TTCGAA 2 cut(s) 79, 100
BsrI ACTGG 1 cut(s) 494
BssMI GATC 1 cut(s) 51
BstBI TTCGAA 2 cut(s) 79, 100
BstDEI CTNAG 2 cut(s) 271, 317
BstKTI GATC 1 cut(s) 54
BstMAI GTCTC 1 cut(s) 388
BstMBI GATC 1 cut(s) 51
BstX2I RGATCY 1 cut(s) 51
BstYI RGATCY 1 cut(s) 51
BtsIMutI CAGTG 1 cut(s) 487
CaiI CAGNNNCTG 1 cut(s) 179
Csp6I GTAC 2 cut(s) 16, 232
CviAII CATG 2 cut(s) 119, 168
CviJI RGCY 4 cut(s) 90, 270, 316, 445
CviKI_1 RGCY 4 cut(s) 90, 270, 316, 445
CviQI GTAC 2 cut(s) 16, 232
DdeI CTNAG 2 cut(s) 271, 317
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Eco57I CTGAAG 2 cut(s) 250, 359
EcoRI GAATTC 2 cut(s) 163, 296
EcoT22I ATGCAT 1 cut(s) 120
FaeI CATG 2 cut(s) 122, 171
FatI CATG 2 cut(s) 118, 167
FauNDI CATATG 1 cut(s) 214
FspBI CTAG 1 cut(s) 499
Hin1II CATG 2 cut(s) 122, 171
HinfI GANTC 1 cut(s) 245
Hpy188I TCNGA 1 cut(s) 187
Hpy188III TCNNGA 1 cut(s) 197
HpyAV CCTTC 2 cut(s) 96, 383
HpyCH4V TGCA 5 cut(s) 110, 118, 173, 341, 362
HpyF3I CTNAG 2 cut(s) 271, 317
Hsp92II CATG 2 cut(s) 122, 171
Kzo9I GATC 1 cut(s) 51
LmnI GCTCC 2 cut(s) 313, 442
LpnPI CCDG 3 cut(s) 210, 434, 475
MaeI CTAG 1 cut(s) 499
MaeIII GTNAC 2 cut(s) 224, 494
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 4 cut(s) 46, 56, 256, 292
MflI RGATCY 1 cut(s) 51
MluCI AATT 7 cut(s) 64, 81, 154, 163, 282, 296, 450
MlyI GAGTC 1 cut(s) 254
MmeI TCCRAC 1 cut(s) 165
MnlI CCTC 6 cut(s) 136, 181, 315, 340, 449, 457
Mph1103I ATGCAT 1 cut(s) 120
MroXI GAANNNNTTC 1 cut(s) 372
MseI TTAA 1 cut(s) 285
NdeI CATATG 1 cut(s) 214
NdeII GATC 1 cut(s) 51
NlaIII CATG 2 cut(s) 122, 171
NmuCI GTSAC 1 cut(s) 224
NsiI ATGCAT 1 cut(s) 120
NspV TTCGAA 2 cut(s) 79, 100
PdmI GAANNNNTTC 1 cut(s) 372
PleI GAGTC 1 cut(s) 253
PpsI GAGTC 1 cut(s) 253
PstNI CAGNNNCTG 1 cut(s) 179
PsuI RGATCY 1 cut(s) 51
RsaI GTAC 2 cut(s) 17, 233
RsaNI GTAC 2 cut(s) 16, 232
SaqAI TTAA 1 cut(s) 285
Sau3AI GATC 1 cut(s) 51
SchI GAGTC 1 cut(s) 254
SetI ASST 8 cut(s) 107, 147, 272, 318, 348, 423, 447, 468
SfuI TTCGAA 2 cut(s) 79, 100
Sse9I AATT 7 cut(s) 64, 81, 154, 163, 282, 296, 450
SspMI CTAG 1 cut(s) 499
TaqI TCGA 2 cut(s) 79, 100
TasI AATT 7 cut(s) 64, 81, 154, 163, 282, 296, 450
TatI WGTACW 1 cut(s) 231
Tru1I TTAA 1 cut(s) 285
Tru9I TTAA 1 cut(s) 285
TscAI CASTG 1 cut(s) 494
TseFI GTSAC 1 cut(s) 224
Tsp45I GTSAC 1 cut(s) 224
TspDTI ATGAA 3 cut(s) 156, 176, 201
TspRI CASTG 1 cut(s) 494
XapI RAATTY 3 cut(s) 154, 163, 296
XmnI GAANNNNTTC 1 cut(s) 372
XspI CTAG 1 cut(s) 499
Zsp2I ATGCAT 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.