Rmu_sc0003511.1_g000008

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003511.1
OG0006528
Physical Location & Seq
Reverse (-)
37495 .. 39272
1778 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003511.1_g000008.1.cds

Sequence Viewer

Length: 411 bp
atgatgagtgctgatgagcttttctcaaaggggaggttgctgccttacaagggaagcaacaagagccagatgcagaggggtactaccactcttagagacgagcttcttgtggaggatcgggaggacgacgtgtcgtttcataggtcgccaaaggggtcatcgacgaggtggaaagggcttctggggcggaagaggactgcgcacattaggtccaagaaagctgagagaggtagtgatggctcttttatggaaggaagaaggtctggccttgtgcatgagagttattcttcacagatggaaccacttgcatataggaaaatggactttgaagaattttgtgctgctgcaattagcacgcatcaattggaggccctcgaaggatgggagcagatagcatctactgctttttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

136

Amino Acids

15.44

Weight (kDa)

8.76

Isoelectric Point (pI)

54.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 201
AciI CCGC 1 cut(s) 187
AclWI GGATC 1 cut(s) 123
AcsI RAATTY 1 cut(s) 332
AfaI GTAC 1 cut(s) 82
AfiI CCNNNNNNNGG 1 cut(s) 50
AflIII ACRYGT 1 cut(s) 129
AgsI TTSAA 1 cut(s) 329
AhdI GACNNNNNGTC 1 cut(s) 130
AjiI CACGTC 1 cut(s) 130
AluBI AGCT 3 cut(s) 19, 103, 221
AluI AGCT 3 cut(s) 19, 103, 221
Alw26I GTCTC 1 cut(s) 90
AlwI GGATC 1 cut(s) 123
AoxI GGCC 2 cut(s) 265, 369
ApeKI GCWGC 3 cut(s) 40, 341, 344
ApoI RAATTY 1 cut(s) 332
AspLEI GCGC 1 cut(s) 202
AspS9I GGNCC 2 cut(s) 210, 370
AvaII GGWCC 1 cut(s) 210
BbvI GCAGC 3 cut(s) 27, 328, 331
BccI CCATC 3 cut(s) 230, 289, 375
BcoDI GTCTC 1 cut(s) 90
BisI GCNGC 3 cut(s) 41, 342, 345
BlsI GCNGC 3 cut(s) 42, 343, 346
Bme18I GGWCC 1 cut(s) 210
BmeRI GACNNNNNGTC 1 cut(s) 130
BmgBI CACGTC 1 cut(s) 130
BmgT120I GGNCC 2 cut(s) 210, 370
BmiI GGNNCC 1 cut(s) 300
BmsI GCATC 3 cut(s) 60, 367, 404
BplI GAGNNNNNCTC 2 cut(s) 8, 40
Bsc4I CCNNNNNNNGG 1 cut(s) 50
BseGI GGATG 1 cut(s) 386
BseLI CCNNNNNNNGG 1 cut(s) 50
BseMII CTCAG 1 cut(s) 213
BseXI GCAGC 3 cut(s) 27, 328, 331
BshFI GGCC 2 cut(s) 267, 371
BslI CCNNNNNNNGG 1 cut(s) 50
BsmAI GTCTC 1 cut(s) 90
BsmBI CGTCTC 1 cut(s) 90
BsnI GGCC 2 cut(s) 267, 371
Bsp143I GATC 1 cut(s) 115
BspACI CCGC 1 cut(s) 187
BspANI GGCC 2 cut(s) 267, 371
BspCNI CTCAG 1 cut(s) 214
BspLI GGNNCC 1 cut(s) 300
BspPI GGATC 1 cut(s) 123
BssMI GATC 1 cut(s) 115
Bst6I CTCTTC 1 cut(s) 185
BstAPI GCANNNNNTGC 1 cut(s) 401
BstC8I GCNNGC 1 cut(s) 356
BstDEI CTNAG 2 cut(s) 92, 222
BstF5I GGATG 1 cut(s) 386
BstHHI GCGC 1 cut(s) 202
BstKTI GATC 1 cut(s) 118
BstMAI GTCTC 1 cut(s) 90
BstMBI GATC 1 cut(s) 115
BstMWI GCNNNNNNNGC 3 cut(s) 63, 184, 401
BstV1I GCAGC 3 cut(s) 27, 328, 331
BsuRI GGCC 2 cut(s) 267, 371
BtrI CACGTC 1 cut(s) 130
BtsCI GGATG 1 cut(s) 386
Cac8I GCNNGC 1 cut(s) 356
CfoI GCGC 1 cut(s) 202
Cfr13I GGNCC 2 cut(s) 210, 370
Csp6I GTAC 1 cut(s) 81
CviAII CATG 1 cut(s) 275
CviJI RGCY 8 cut(s) 19, 66, 103, 178, 221, 240, 267, 371
CviKI_1 RGCY 8 cut(s) 19, 66, 103, 178, 221, 240, 267, 371
CviQI GTAC 1 cut(s) 81
DdeI CTNAG 2 cut(s) 92, 222
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
DriI GACNNNNNGTC 1 cut(s) 130
Eam1104I CTCTTC 1 cut(s) 185
Eam1105I GACNNNNNGTC 1 cut(s) 130
EarI CTCTTC 1 cut(s) 185
EciI GGCGGA 1 cut(s) 202
Eco47I GGWCC 1 cut(s) 210
EcoO109I RGGNCCY 1 cut(s) 370
Esp3I CGTCTC 1 cut(s) 90
FaeI CATG 1 cut(s) 278
FaiI YATR 5 cut(s) 141, 248, 276, 310, 312
FatI CATG 1 cut(s) 274
Fnu4HI GCNGC 3 cut(s) 41, 342, 345
FokI GGATG 1 cut(s) 393
Fsp4HI GCNGC 3 cut(s) 41, 342, 345
FspI TGCGCA 1 cut(s) 201
GlaI GCGC 1 cut(s) 201
GluI GCNGC 3 cut(s) 41, 342, 345
HaeIII GGCC 2 cut(s) 267, 371
HhaI GCGC 1 cut(s) 202
Hin1II CATG 1 cut(s) 278
Hin6I GCGC 1 cut(s) 200
HinP1I GCGC 1 cut(s) 200
Hpy188III TCNNGA 1 cut(s) 119
Hpy99I CGWCG 2 cut(s) 131, 166
HpyAV CCTTC 3 cut(s) 245, 252, 371
HpyCH4IV ACGT 1 cut(s) 129
HpyCH4V TGCA 4 cut(s) 73, 274, 308, 347
HpyF10VI GCNNNNNNNGC 3 cut(s) 63, 184, 401
HpyF3I CTNAG 2 cut(s) 92, 222
HpySE526I ACGT 1 cut(s) 129
Hsp92II CATG 1 cut(s) 278
HspAI GCGC 1 cut(s) 200
Kzo9I GATC 1 cut(s) 115
LmnI GCTCC 1 cut(s) 385
LpnPI CCDG 3 cut(s) 80, 167, 249
Lsp1109I GCAGC 3 cut(s) 27, 328, 331
LweI GCATC 3 cut(s) 60, 367, 404
MaeII ACGT 1 cut(s) 129
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 4 cut(s) 202, 267, 279, 341
MfeI CAATTG 1 cut(s) 362
MluCI AATT 3 cut(s) 332, 348, 362
MnlI CCTC 9 cut(s) 27, 69, 106, 115, 159, 186, 221, 361, 383
MseI TTAA 1 cut(s) 409
MunI CAATTG 1 cut(s) 362
MwoI GCNNNNNNNGC 3 cut(s) 63, 184, 401
NdeII GATC 1 cut(s) 115
NlaIII CATG 1 cut(s) 278
NlaIV GGNNCC 1 cut(s) 300
NsbI TGCGCA 1 cut(s) 201
PkrI GCNGC 3 cut(s) 42, 343, 346
PspN4I GGNNCC 1 cut(s) 300
PspPI GGNCC 2 cut(s) 210, 370
RsaI GTAC 1 cut(s) 82
RsaNI GTAC 1 cut(s) 81
SaqAI TTAA 1 cut(s) 409
SatI GCNGC 3 cut(s) 41, 342, 345
Sau3AI GATC 1 cut(s) 115
Sau96I GGNCC 2 cut(s) 210, 370
SfaNI GCATC 3 cut(s) 60, 367, 404
SinI GGWCC 1 cut(s) 210
Sse9I AATT 3 cut(s) 332, 348, 362
SsiI CCGC 1 cut(s) 187
TaiI ACGT 1 cut(s) 132
TaqI TCGA 2 cut(s) 161, 375
TasI AATT 3 cut(s) 332, 348, 362
Tru1I TTAA 1 cut(s) 409
Tru9I TTAA 1 cut(s) 409
TseI GCWGC 3 cut(s) 40, 341, 344
TspDTI ATGAA 1 cut(s) 128
VpaK11BI GGWCC 1 cut(s) 210
XapI RAATTY 1 cut(s) 332
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.