Rmu_sc0004279.1_g000022

Polyadenylate-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004279.1
Physical Location & Seq
Forward (+)
92820 .. 93610
791 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004279.1_g000022.1.cds

Sequence Viewer

Length: 468 bp
atgcagcttcatatcagagttctccagattgcaaagaatgagaccgatcccaatattacaactgtgggatatctggatgacaacgtttctgatgatcatttgagaacagtttttagccagtatggtgagctagttcatgttaagataccagcaggcaagcgatgtgggtttgttcagttcgcagacaggagccgtgctgaagaggctttgcaaggattaaacaattctcagattggtggacaaaatatccgactttcttggggtcgcagtccttcaaacaagcagcaggctcaggcagatccaaaccaatggaatgctggctattatggatatgcaccaacccccgagggatatggatatgcccaagtatcccaagaccctaacatgtactatggagggtatcctgctggatatggcaattaccagcagtcacagcagcaacagcagcagcaagtgggttatagttga

Protein Analysis

155

Amino Acids

17.36

Weight (kDa)

5.84

Isoelectric Point (pI)

59.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 84
AclWI GGATC 2 cut(s) 41, 293
AcuI CTGAAG 1 cut(s) 219
AfaI GTAC 1 cut(s) 389
AflIII ACRYGT 1 cut(s) 384
AgsI TTSAA 1 cut(s) 276
AluBI AGCT 2 cut(s) 7, 130
AluI AGCT 2 cut(s) 7, 130
Alw26I GTCTC 1 cut(s) 35
AlwI GGATC 2 cut(s) 41, 293
Ama87I CYCGRG 1 cut(s) 344
ApeKI GCWGC 5 cut(s) 4, 283, 436, 445, 448
AsuHPI GGTGA 1 cut(s) 137
AvaI CYCGRG 1 cut(s) 344
BbvI GCAGC 5 cut(s) 16, 295, 448, 457, 460
BceAI ACGGC 1 cut(s) 177
BciVI GTATCC 2 cut(s) 379, 411
BclI TGATCA 1 cut(s) 94
BcoDI GTCTC 1 cut(s) 35
BfaI CTAG 1 cut(s) 131
BfuI GTATCC 2 cut(s) 379, 411
BisI GCNGC 5 cut(s) 5, 284, 437, 446, 449
BlsI GCNGC 5 cut(s) 6, 285, 438, 447, 450
BmeT110I CYCGRG 1 cut(s) 344
BmiI GGNNCC 1 cut(s) 191
BpmI CTGGAG 1 cut(s) 8
Bpu10I CCTNAGC 1 cut(s) 291
BsaI GGTCTC 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 345
Bse1I ACTGG 1 cut(s) 118
BseDI CCNNGG 1 cut(s) 345
BseGI GGATG 1 cut(s) 82
BseMII CTCAG 2 cut(s) 242, 305
BseNI ACTGG 1 cut(s) 118
BseXI GCAGC 5 cut(s) 16, 295, 448, 457, 460
BsiHKCI CYCGRG 1 cut(s) 344
BsmAI GTCTC 1 cut(s) 35
BsmI GAATGC 1 cut(s) 319
Bso31I GGTCTC 1 cut(s) 35
BsoBI CYCGRG 1 cut(s) 344
Bsp143I GATC 3 cut(s) 46, 94, 298
BspCNI CTCAG 2 cut(s) 241, 304
BspLI GGNNCC 1 cut(s) 191
BspPI GGATC 2 cut(s) 41, 293
BspTNI GGTCTC 1 cut(s) 35
BsrI ACTGG 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 345
BssMI GATC 3 cut(s) 46, 94, 298
Bst4CI ACNGT 2 cut(s) 64, 109
Bst6I CTCTTC 1 cut(s) 195
BstC8I GCNNGC 4 cut(s) 154, 158, 288, 319
BstDEI CTNAG 2 cut(s) 228, 291
BstF5I GGATG 1 cut(s) 82
BstKTI GATC 3 cut(s) 49, 97, 301
BstMAI GTCTC 1 cut(s) 35
BstMBI GATC 3 cut(s) 46, 94, 298
BstMWI GCNNNNNNNGC 4 cut(s) 203, 433, 442, 445
BstNSI RCATGY 1 cut(s) 388
BstV1I GCAGC 5 cut(s) 16, 295, 448, 457, 460
BstX2I RGATCY 1 cut(s) 298
BstXI CCANNNNNNTGG 1 cut(s) 309
BstYI RGATCY 1 cut(s) 298
BsuI GTATCC 2 cut(s) 379, 411
BtgZI GCGATG 1 cut(s) 175
BtsCI GGATG 1 cut(s) 82
Cac8I GCNNGC 4 cut(s) 154, 158, 288, 319
Csp6I GTAC 1 cut(s) 388
CspCI CAANNNNNGTGG 2 cut(s) 145, 180
CviAII CATG 2 cut(s) 137, 385
CviJI RGCY 7 cut(s) 7, 117, 130, 192, 206, 290, 321
CviKI_1 RGCY 7 cut(s) 7, 117, 130, 192, 206, 290, 321
CviQI GTAC 1 cut(s) 388
DdeI CTNAG 2 cut(s) 228, 291
DpnI GATC 3 cut(s) 48, 96, 300
DpnII GATC 3 cut(s) 46, 94, 298
Eam1104I CTCTTC 1 cut(s) 195
EarI CTCTTC 1 cut(s) 195
Eco31I GGTCTC 1 cut(s) 35
Eco32I GATATC 1 cut(s) 71
Eco57I CTGAAG 1 cut(s) 219
Eco88I CYCGRG 1 cut(s) 344
EcoRV GATATC 1 cut(s) 71
FaeI CATG 2 cut(s) 140, 388
FatI CATG 2 cut(s) 136, 384
FbaI TGATCA 1 cut(s) 94
Fnu4HI GCNGC 5 cut(s) 5, 284, 437, 446, 449
FokI GGATG 1 cut(s) 89
Fsp4HI GCNGC 5 cut(s) 5, 284, 437, 446, 449
FspBI CTAG 1 cut(s) 131
GluI GCNGC 5 cut(s) 5, 284, 437, 446, 449
GsuI CTGGAG 1 cut(s) 8
Hin1II CATG 2 cut(s) 140, 388
HphI GGTGA 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 239
Hpy188I TCNGA 4 cut(s) 17, 91, 231, 251
Hpy188III TCNNGA 2 cut(s) 25, 74
Hpy8I GTNNAC 1 cut(s) 239
HpyAV CCTTC 1 cut(s) 282
HpyCH4III ACNGT 2 cut(s) 64, 109
HpyCH4IV ACGT 1 cut(s) 84
HpyCH4V TGCA 4 cut(s) 4, 32, 211, 335
HpyF10VI GCNNNNNNNGC 4 cut(s) 203, 433, 442, 445
HpyF3I CTNAG 2 cut(s) 228, 291
HpySE526I ACGT 1 cut(s) 84
Hsp92II CATG 2 cut(s) 140, 388
Ksp22I TGATCA 1 cut(s) 94
Kzo9I GATC 3 cut(s) 46, 94, 298
LmnI GCTCC 1 cut(s) 189
Lsp1109I GCAGC 5 cut(s) 16, 295, 448, 457, 460
MaeI CTAG 1 cut(s) 131
MaeII ACGT 1 cut(s) 84
MaeIII GTNAC 1 cut(s) 429
MalI GATC 3 cut(s) 48, 96, 300
MboI GATC 3 cut(s) 46, 94, 298
MboII GAAGA 1 cut(s) 212
MflI RGATCY 1 cut(s) 298
MluCI AATT 2 cut(s) 223, 418
MmeI TCCRAC 1 cut(s) 274
MnlI CCTC 3 cut(s) 196, 340, 389
MseI TTAA 2 cut(s) 141, 218
Mva1269I GAATGC 1 cut(s) 319
MwoI GCNNNNNNNGC 4 cut(s) 203, 433, 442, 445
NdeII GATC 3 cut(s) 46, 94, 298
NlaIII CATG 2 cut(s) 140, 388
NlaIV GGNNCC 1 cut(s) 191
NmuCI GTSAC 1 cut(s) 429
NspI RCATGY 1 cut(s) 388
PciI ACATGT 1 cut(s) 384
PctI GAATGC 1 cut(s) 319
PkrI GCNGC 5 cut(s) 6, 285, 438, 447, 450
PscI ACATGT 1 cut(s) 384
Psp1406I AACGTT 1 cut(s) 84
PspN4I GGNNCC 1 cut(s) 191
PsuI RGATCY 1 cut(s) 298
RsaI GTAC 1 cut(s) 389
RsaNI GTAC 1 cut(s) 388
SaqAI TTAA 2 cut(s) 141, 218
SatI GCNGC 5 cut(s) 5, 284, 437, 446, 449
Sau3AI GATC 3 cut(s) 46, 94, 298
SetI ASST 3 cut(s) 9, 87, 132
Sse9I AATT 2 cut(s) 223, 418
SspI AATATT 1 cut(s) 55
SspMI CTAG 1 cut(s) 131
TaaI ACNGT 2 cut(s) 64, 109
TaiI ACGT 1 cut(s) 87
TaqII GACCGA 1 cut(s) 59
TasI AATT 2 cut(s) 223, 418
TatI WGTACW 1 cut(s) 387
Tru1I TTAA 2 cut(s) 141, 218
Tru9I TTAA 2 cut(s) 141, 218
TseFI GTSAC 1 cut(s) 429
TseI GCWGC 5 cut(s) 4, 283, 436, 445, 448
Tsp45I GTSAC 1 cut(s) 429
TspDTI ATGAA 1 cut(s) 125
XceI RCATGY 1 cut(s) 388
XcmI CCANNNNNNNNNTGG 1 cut(s) 314
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.