Rmu_sc0006147.1_g000005

Two-component response regulator-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006147.1
Physical Location & Seq
Reverse (-)
17109 .. 17399
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006147.1_g000005.1.cds

Sequence Viewer

Length: 291 bp
atggttcaagatgaaggtatccaagcagaaatttgtgaagaaaaagctaaaactgctagtggaactcacagcttccaatatgaggttgaaccgtcagttggggttagggacttgctttgcacctttgacaattggcccaactgcaacgttggaagttctaacagaaaagatgatggtatgaagcactttggattggaactgtctttaagaagttcgaatggttcacacaaggaagtgactgaggagaggcctgcaccgaaacattctgatgcctctaccttttcacagtga

Protein Analysis

96

Amino Acids

10.62

Weight (kDa)

5.08

Isoelectric Point (pI)

45.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 147
AcsI RAATTY 1 cut(s) 30
AfiI CCNNNNNNNGG 2 cut(s) 82, 98
AgsI TTSAA 2 cut(s) 8, 89
AjuI GAANNNNNNNTTGG 2 cut(s) 81, 113
AluBI AGCT 2 cut(s) 47, 72
AluI AGCT 2 cut(s) 47, 72
AoxI GGCC 2 cut(s) 134, 248
ApoI RAATTY 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 135
AsuII TTCGAA 1 cut(s) 215
BccI CCATC 1 cut(s) 167
BciVI GTATCC 1 cut(s) 29
BfaI CTAG 1 cut(s) 57
BfuI GTATCC 1 cut(s) 29
BmgT120I GGNCC 1 cut(s) 135
BmsI GCATC 1 cut(s) 259
Bpu14I TTCGAA 1 cut(s) 215
Bsc4I CCNNNNNNNGG 2 cut(s) 82, 98
BseLI CCNNNNNNNGG 2 cut(s) 82, 98
BseMII CTCAG 1 cut(s) 231
BseRI GAGGAG 1 cut(s) 257
BsgI GTGCAG 1 cut(s) 237
BshFI GGCC 2 cut(s) 136, 250
BslFI GGGAC 1 cut(s) 122
BslI CCNNNNNNNGG 2 cut(s) 82, 98
BsmFI GGGAC 1 cut(s) 122
BsnI GGCC 2 cut(s) 136, 250
Bsp119I TTCGAA 1 cut(s) 215
BspANI GGCC 2 cut(s) 136, 250
BspCNI CTCAG 1 cut(s) 232
BspT104I TTCGAA 1 cut(s) 215
Bst4CI ACNGT 3 cut(s) 93, 201, 288
BstBI TTCGAA 1 cut(s) 215
BstC8I GCNNGC 1 cut(s) 252
BstDEI CTNAG 1 cut(s) 240
BstMWI GCNNNNNNNGC 1 cut(s) 53
BsuI GTATCC 1 cut(s) 29
BsuRI GGCC 2 cut(s) 136, 250
Cac8I GCNNGC 1 cut(s) 252
Cfr13I GGNCC 1 cut(s) 135
CviJI RGCY 4 cut(s) 47, 72, 136, 250
CviKI_1 RGCY 4 cut(s) 47, 72, 136, 250
DdeI CTNAG 1 cut(s) 240
Eco147I AGGCCT 1 cut(s) 250
FaiI YATR 2 cut(s) 81, 179
FaqI GGGAC 1 cut(s) 122
FspBI CTAG 1 cut(s) 57
HaeIII GGCC 2 cut(s) 136, 250
Hpy166II GTNNAC 1 cut(s) 224
Hpy188I TCNGA 1 cut(s) 268
Hpy188III TCNNGA 1 cut(s) 8
Hpy8I GTNNAC 1 cut(s) 224
HpyAV CCTTC 1 cut(s) 8
HpyCH4III ACNGT 3 cut(s) 93, 201, 288
HpyCH4IV ACGT 1 cut(s) 147
HpyCH4V TGCA 3 cut(s) 120, 144, 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 240
HpySE526I ACGT 1 cut(s) 147
LpnPI CCDG 1 cut(s) 264
LweI GCATC 1 cut(s) 259
MaeI CTAG 1 cut(s) 57
MaeII ACGT 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 235
MboII GAAGA 1 cut(s) 50
MfeI CAATTG 1 cut(s) 130
MluCI AATT 2 cut(s) 30, 130
MmeI TCCRAC 1 cut(s) 130
MnlI CCTC 4 cut(s) 76, 235, 240, 283
MseI TTAA 1 cut(s) 206
MslI CAYNNNNRTG 1 cut(s) 267
MunI CAATTG 1 cut(s) 130
MwoI GCNNNNNNNGC 1 cut(s) 53
NmuCI GTSAC 1 cut(s) 235
NspV TTCGAA 1 cut(s) 215
PceI AGGCCT 1 cut(s) 250
Psp1406I AACGTT 1 cut(s) 147
PspPI GGNCC 1 cut(s) 135
RseI CAYNNNNRTG 1 cut(s) 267
SaqAI TTAA 1 cut(s) 206
Sau96I GGNCC 1 cut(s) 135
SetI ASST 7 cut(s) 19, 49, 74, 87, 125, 150, 281
SfaNI GCATC 1 cut(s) 259
SfuI TTCGAA 1 cut(s) 215
SgeI CNNG 6 cut(s) 20, 35, 69, 124, 241, 263
SmiMI CAYNNNNRTG 1 cut(s) 267
Sse9I AATT 2 cut(s) 30, 130
SseBI AGGCCT 1 cut(s) 250
SspMI CTAG 1 cut(s) 57
StuI AGGCCT 1 cut(s) 250
TaaI ACNGT 3 cut(s) 93, 201, 288
TaiI ACGT 1 cut(s) 150
TaqI TCGA 1 cut(s) 215
TasI AATT 2 cut(s) 30, 130
Tru1I TTAA 1 cut(s) 206
Tru9I TTAA 1 cut(s) 206
TseFI GTSAC 1 cut(s) 235
Tsp45I GTSAC 1 cut(s) 235
TspDTI ATGAA 2 cut(s) 27, 194
XapI RAATTY 1 cut(s) 30
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.