Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008093.1

Orthogroup ID

OG0003496

Physical Location & Seq

Genomic Coordinates Reverse (-)

17327 .. 20239

Gene Structure 2913 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008093.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1017 bp

atgggagtggactactacaagatactccaggtcgataagaacgcaaaagatgaggatttgaagaaggcttatcggaagctcgccatgaaatggcatcccgacaagaatcccaataacaagaaacaagccgaagccaagttcaaagaagtttcggaagcctatgaggttctgagtgatccccagaaaagagcagtgtatgatcagtatggtgaagaggggctaaagggtcaagtgccaccttctgactttggaggagcttcctacttctcaactggaaatgggccaacagcgtttcattttaatcctcgaaatgcagacgacatatttgccgagttttttggcacgagagggggagggttttcaagtagcttgtttggtgatagtagcttctttggtgatagtagcttctttggtgacaatgcatttgcttttagagaaggtggaggtggttcaatgaaatacggtggtcctcgcaaagcctctccaattgagaacaggttgccttgtagccttgaagagctttacaaaggaactagcaagaagatgaagatatccagatatattgctgacaccagtgggaagggcatggaggtggaggaaattctgaccattgacataaaacctggctggaagaagggtactaaaattacctttccagagaaaggaaatgaacagccaaatgttattcctgcagatcttgttttcattattgacgagaagccacacagtgtgttcactcgtgatggaaatgacttgatagtgacacagaatatatctttggtcgaggctcttactggctacactgtcaacctcaccaccctggatggtaggagattaaccatcccagtcaataatgtagttcatccaagctatgaggaggttgttctaggggaaggaatgccaatccagaaagaacccaccaaaagaggcaagctgagaataaaattcaacatcaagttcccaacaaggttgacagcagagcagaaggctggaatcaagaagcttttaggatactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000226 GO:0001578 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005856 GO:0005929 GO:0005930 GO:0006996 GO:0007010 GO:0007017 GO:0008150 GO:0009987 GO:0016043 GO:0022607 GO:0030030 GO:0030031 GO:0031514 GO:0032838 GO:0035082 GO:0036126 GO:0042995 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0044085 GO:0044422 GO:0044424 GO:0044430 GO:0044441 GO:0044444 GO:0044446 GO:0044463 GO:0044464 GO:0044782 GO:0060271 GO:0070925 GO:0071840 GO:0097014 GO:0097223 GO:0097224 GO:0097729 GO:0099568 GO:0120025 GO:0120031 GO:0120036 GO:0120038 GO:1904158

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DnaJ DnaJ_C

Protein Analysis

338

Amino Acids

37.57

Weight (kDa)

8.9

Isoelectric Point (pI)

30.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003496)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G20560 AT4G28480 AT4G28480
fragaria_vesca	FvH4_3g08630 FvH4_6g26690
malus_domestica	MD05G1310300.v1.1 MD10G1289200.v1.1
prunus_persica	Prupe.4G052500_v2.0.a1
pyrus_communis	pycom05g28670 pycom10g24180
rosa_chinensis	RchiOBHm_Chr2g0127101 RchiOBHm_Chr5g0009211
rosa_laevigata	RLG00000018979 RLG00000031634 RLG00000031638 RLG00000031640
rosa_multiflora	Rmu_sc0006233.1_g000031 Rmu_sc0008093.1_g000002
rosa_roxburghii	Rroxscaffold_1G00066850 Rroxscaffold_1G00067550 Rroxscaffold_2G00115770 Rroxscaffold_2G00116220
rosa_rugosa	Rorug02G0277300 Rorug02G0277400 Rorug04G0441500
rosa_samantha	Rh2AG327900 Rh2BG337900 Rh2CG315000 Rh2DG355000 Rh5AG071300 Rh5BG067800 Rh5CG080100 Rh5DG067800
rosa_wichuraiana	Rw2G026600 Rw5G006660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	90
AclWI	GGATC	1 cut(s)	170
AcsI	RAATTY	2 cut(s)	600, 944
AdeI	CACNNNGTG	2 cut(s)	728, 730
AfaI	GTAC	1 cut(s)	640
AfiI	CCNNNNNNNGG	2 cut(s)	90, 662
AgsI	TTSAA	6 cut(s)	61, 142, 363, 453, 515, 949
AjnI	CCWGG	3 cut(s)	27, 622, 819
AjuI	GAANNNNNNNTTGG	2 cut(s)	761, 793
AluBI	AGCT	9 cut(s)	79, 257, 369, 387, 405, 520, 870, 934, 1003
AluI	AGCT	9 cut(s)	79, 257, 369, 387, 405, 520, 870, 934, 1003
AlwI	GGATC	1 cut(s)	170
AoxI	GGCC	1 cut(s)	281
ApoI	RAATTY	2 cut(s)	600, 944
ArsI	GACNNNNNNTTYG	4 cut(s)	308, 340, 407, 439
AspS9I	GGNCC	2 cut(s)	281, 467
AsuHPI	GGTGA	5 cut(s)	221, 389, 407, 425, 805
AvaII	GGWCC	1 cut(s)	467
BauI	CACGAG	2 cut(s)	343, 738
BccI	CCATC	3 cut(s)	737, 818, 848
BcgI	CGANNNNNNTGC	2 cut(s)	308, 342
BciT130I	CCWGG	3 cut(s)	29, 624, 821
BciVI	GTATCC	1 cut(s)	1004
BclI	TGATCA	1 cut(s)	199
BfaI	CTAG	2 cut(s)	534, 887
BfmI	CTRYAG	1 cut(s)	690
BfuI	GTATCC	1 cut(s)	1004
BglII	AGATCT	1 cut(s)	694
Bme1390I	CCNGG	3 cut(s)	29, 624, 821
Bme18I	GGWCC	1 cut(s)	467
BmgT120I	GGNCC	2 cut(s)	281, 467
BmrFI	CCNGG	3 cut(s)	29, 624, 821
BmrI	ACTGGG	1 cut(s)	839
BmsI	GCATC	1 cut(s)	103
BmuI	ACTGGG	1 cut(s)	839
BpmI	CTGGAG	1 cut(s)	11
BsaJI	CCNNGG	1 cut(s)	819
Bsc4I	CCNNNNNNNGG	2 cut(s)	90, 662
Bse1I	ACTGG	4 cut(s)	277, 573, 799, 845
BseBI	CCWGG	3 cut(s)	29, 624, 821
BseDI	CCNNGG	1 cut(s)	819
BseGI	GGATG	4 cut(s)	94, 829, 840, 862
BseLI	CCNNNNNNNGG	2 cut(s)	90, 662
BseMII	CTCAG	2 cut(s)	161, 926
BseNI	ACTGG	4 cut(s)	277, 573, 799, 845
BseRI	GAGGAG	2 cut(s)	267, 890
BshFI	GGCC	1 cut(s)	283
BslI	CCNNNNNNNGG	2 cut(s)	90, 662
BsmI	GAATGC	1 cut(s)	903
BsnI	GGCC	1 cut(s)	283
Bsp143I	GATC	3 cut(s)	175, 199, 694
BspANI	GGCC	1 cut(s)	283
BspCNI	CTCAG	2 cut(s)	162, 927
BspMAI	CTGCAG	1 cut(s)	694
BspPI	GGATC	1 cut(s)	170
BspQI	GCTCTTC	1 cut(s)	510
BsrI	ACTGG	4 cut(s)	277, 573, 799, 845
BssECI	CCNNGG	1 cut(s)	819
BssMI	GATC	3 cut(s)	175, 199, 694
BssSI	CACGAG	2 cut(s)	343, 738
Bst2BI	CACGAG	2 cut(s)	343, 738
Bst2UI	CCWGG	3 cut(s)	29, 624, 821
Bst4CI	ACNGT	3 cut(s)	464, 728, 805
Bst6I	CTCTTC	2 cut(s)	207, 510
BstC8I	GCNNGC	2 cut(s)	81, 932
BstDEI	CTNAG	2 cut(s)	170, 935
BstF5I	GGATG	4 cut(s)	94, 829, 840, 862
BstKTI	GATC	3 cut(s)	178, 202, 697
BstMBI	GATC	3 cut(s)	175, 199, 694
BstNI	CCWGG	3 cut(s)	29, 624, 821
BstSCI	CCNGG	3 cut(s)	27, 622, 819
BstSFI	CTRYAG	1 cut(s)	690
BstX2I	RGATCY	1 cut(s)	694
BstYI	RGATCY	1 cut(s)	694
BsuI	GTATCC	1 cut(s)	1004
BsuRI	GGCC	1 cut(s)	283
BtsCI	GGATG	4 cut(s)	94, 829, 840, 862
BtsI	GCAGTG	1 cut(s)	198
BtsIMutI	CAGTG	4 cut(s)	198, 580, 733, 801
Cac8I	GCNNGC	2 cut(s)	81, 932
Cfr13I	GGNCC	2 cut(s)	281, 467
Csp6I	GTAC	1 cut(s)	639
CviAII	CATG	2 cut(s)	85, 586
CviQI	GTAC	1 cut(s)	639
DdeI	CTNAG	2 cut(s)	170, 935
DpnI	GATC	3 cut(s)	177, 201, 696
DpnII	GATC	3 cut(s)	175, 199, 694
DraIII	CACNNNGTG	2 cut(s)	728, 730
Eam1104I	CTCTTC	2 cut(s)	207, 510
EarI	CTCTTC	2 cut(s)	207, 510
Eco32I	GATATC	1 cut(s)	552
Eco47I	GGWCC	1 cut(s)	467
EcoRII	CCWGG	3 cut(s)	27, 622, 819
EcoRV	GATATC	1 cut(s)	552
EcoT22I	ATGCAT	1 cut(s)	424
FaeI	CATG	2 cut(s)	88, 589
FatI	CATG	2 cut(s)	84, 585
FbaI	TGATCA	1 cut(s)	199
FokI	GGATG	4 cut(s)	81, 827, 836, 849
FspBI	CTAG	2 cut(s)	534, 887
GsuI	CTGGAG	1 cut(s)	11
HaeIII	GGCC	1 cut(s)	283
Hin1II	CATG	2 cut(s)	88, 589
HincII	GTYRAC	2 cut(s)	808, 972
HindII	GTYRAC	2 cut(s)	808, 972
HindIII	AAGCTT	1 cut(s)	1001
HinfI	GANTC	2 cut(s)	106, 993
HphI	GGTGA	5 cut(s)	221, 389, 407, 425, 805
Hpy166II	GTNNAC	4 cut(s)	10, 735, 808, 972
Hpy188I	TCNGA	5 cut(s)	75, 154, 171, 244, 606
Hpy188III	TCNNGA	6 cut(s)	98, 555, 656, 740, 907, 997
Hpy8I	GTNNAC	4 cut(s)	10, 735, 808, 972
HpyAV	CCTTC	7 cut(s)	58, 249, 431, 574, 628, 887, 979
HpyCH4III	ACNGT	3 cut(s)	464, 728, 805
HpyCH4V	TGCA	3 cut(s)	314, 422, 692
HpyF3I	CTNAG	2 cut(s)	170, 935
Hsp92II	CATG	2 cut(s)	88, 589
Ksp22I	TGATCA	1 cut(s)	199
Kzo9I	GATC	3 cut(s)	175, 199, 694
LguI	GCTCTTC	1 cut(s)	510
LmnI	GCTCC	1 cut(s)	254
LweI	GCATC	1 cut(s)	103
MaeI	CTAG	2 cut(s)	534, 887
MaeIII	GTNAC	2 cut(s)	413, 760
MalI	GATC	3 cut(s)	177, 201, 696
MboI	GATC	3 cut(s)	175, 199, 694
MboII	GAAGA	6 cut(s)	73, 224, 527, 553, 559, 643
MfeI	CAATTG	1 cut(s)	486
MflI	RGATCY	1 cut(s)	694
MluCI	AATT	4 cut(s)	486, 600, 645, 944
Mph1103I	ATGCAT	1 cut(s)	424
MseI	TTAA	2 cut(s)	300, 836
MslI	CAYNNNNRTG	1 cut(s)	590
MspR9I	CCNGG	3 cut(s)	29, 624, 821
MunI	CAATTG	1 cut(s)	486
Mva1269I	GAATGC	1 cut(s)	903
MvaI	CCWGG	3 cut(s)	29, 624, 821
NdeII	GATC	3 cut(s)	175, 199, 694
NlaIII	CATG	2 cut(s)	88, 589
NmeAIII	GCCGAG	1 cut(s)	355
NmuCI	GTSAC	2 cut(s)	413, 760
NsiI	ATGCAT	1 cut(s)	424
PciSI	GCTCTTC	1 cut(s)	510
PctI	GAATGC	1 cut(s)	903
PfeI	GAWTC	2 cut(s)	106, 993
PflMI	CCANNNNNTGG	1 cut(s)	90
Psp6I	CCWGG	3 cut(s)	27, 622, 819
PspGI	CCWGG	3 cut(s)	27, 622, 819
PspPI	GGNCC	2 cut(s)	281, 467
PstI	CTGCAG	1 cut(s)	694
PsuI	RGATCY	1 cut(s)	694
RsaI	GTAC	1 cut(s)	640
RsaNI	GTAC	1 cut(s)	639
RseI	CAYNNNNRTG	1 cut(s)	590
SapI	GCTCTTC	1 cut(s)	510
SaqAI	TTAA	2 cut(s)	300, 836
Sau3AI	GATC	3 cut(s)	175, 199, 694
Sau96I	GGNCC	2 cut(s)	281, 467
ScrFI	CCNGG	3 cut(s)	29, 624, 821
SfaNI	GCATC	1 cut(s)	103
SfcI	CTRYAG	1 cut(s)	690
SinI	GGWCC	1 cut(s)	467
SmiMI	CAYNNNNRTG	1 cut(s)	590
Sse9I	AATT	4 cut(s)	486, 600, 645, 944
SspMI	CTAG	2 cut(s)	534, 887
StyD4I	CCNGG	3 cut(s)	27, 622, 819
TaaI	ACNGT	3 cut(s)	464, 728, 805
TaqI	TCGA	3 cut(s)	33, 307, 783
TasI	AATT	4 cut(s)	486, 600, 645, 944
TfiI	GAWTC	2 cut(s)	106, 993
Tru1I	TTAA	2 cut(s)	300, 836
Tru9I	TTAA	2 cut(s)	300, 836
TscAI	CASTG	4 cut(s)	198, 580, 733, 808
TseFI	GTSAC	2 cut(s)	413, 760
Tsp45I	GTSAC	2 cut(s)	413, 760
TspDTI	ATGAA	7 cut(s)	101, 284, 470, 560, 684, 694, 851
TspRI	CASTG	4 cut(s)	198, 580, 733, 808
Van91I	CCANNNNNTGG	1 cut(s)	90
VpaK11BI	GGWCC	1 cut(s)	467
XapI	RAATTY	2 cut(s)	600, 944
XspI	CTAG	2 cut(s)	534, 887
Zsp2I	ATGCAT	1 cut(s)	424

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.