Rmu_sc0010928.1_g000004

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010928.1
Physical Location & Seq
Forward (+)
20542 .. 24151
3610 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010928.1_g000004.1.cds

Sequence Viewer

Length: 978 bp
atggtggaagagaaggcttggattgcaaaagatgttactgaattggttggcaacactccattggtgtatctcaaccatgtcgtagatggctgcgtggcacgggttgctgctaagctggagatgatggagccttgctctagtgtcaaggataggattggatacagtatgatcacagatgctgaggagaagggtcttattaaggctggtgagagtgtcctggtcgagcctactagtggcaatactggcataggattggcgtttatggcagctgctaagggttacaaactaataatcaccatgcctgcttcaatgagtcttgaaagacgaaccattcttcgaggttttggagctgagcttgttctcacagatcccgccaaaggcatgaagggggctgttcagaaggcacaagagatagtggacaagacacccaatgcttatatgcttcagcaatttgagaaccctgcaaacccaaaggtacattatgaaactactggaccagagatctggagaggctctgctggtaaagtcgacgcctttgtttctgggatagggactggaggtacaataacaggtgctgggaagtacctcaaagagcaaaatcctgatgttaagctctacggtgtagaaccagttgaaagtgctgtcttgtctggagggcgacctggccctcacaagattcaaggaattggtgctggcttcatccctggagttttagatgtcaacctaattgatgaagttatccaaatatcaagtgaagaagcaattgaaacagccaagcgtctagcattgaaggaaggtttgttggtagggatatcatctggtgctgcagctgcagctgctattgagattgcaaggaggccagcaaatgctggaaagctcattgttgtggtcttccccagctttggagagcgttacctctcctctgtattgtttgaatctgtgaagcgggaggcagagaacatggtttttgagccctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

325

Amino Acids

34.46

Weight (kDa)

5.49

Isoelectric Point (pI)

31.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 528
AciI CCGC 2 cut(s) 372, 946
AclWI GGATC 1 cut(s) 362
AcuI CTGAAG 1 cut(s) 428
AcyI GRCGYC 1 cut(s) 531
AfaI GTAC 3 cut(s) 477, 562, 584
AfiI CCNNNNNNNGG 3 cut(s) 233, 377, 902
AgsI TTSAA 7 cut(s) 309, 320, 635, 680, 767, 790, 935
AhlI ACTAGT 1 cut(s) 230
AjnI CCWGG 3 cut(s) 216, 661, 703
AluBI AGCT 9 cut(s) 115, 269, 350, 355, 613, 830, 836, 877, 900
AluI AGCT 9 cut(s) 115, 269, 350, 355, 613, 830, 836, 877, 900
AlwI GGATC 1 cut(s) 362
AlwNI CAGNNNCTG 2 cut(s) 179, 575
AoxI GGCC 2 cut(s) 664, 857
ApeKI GCWGC 9 cut(s) 90, 107, 266, 269, 824, 827, 830, 833, 836
AspS9I GGNCC 2 cut(s) 494, 665
AsuHPI GGTGA 2 cut(s) 218, 286
AvaII GGWCC 1 cut(s) 494
BanII GRGCYC 1 cut(s) 975
BbsI GAAGAC 1 cut(s) 883
BbvCI CCTCAGC 1 cut(s) 180
BbvI GCAGC 9 cut(s) 77, 94, 256, 278, 811, 817, 823, 839, 845
BccI CCATC 2 cut(s) 80, 118
BciT130I CCWGG 3 cut(s) 218, 663, 705
BciVI GTATCC 1 cut(s) 152
BclI TGATCA 1 cut(s) 168
BcuI ACTAGT 1 cut(s) 230
BfaI CTAG 3 cut(s) 138, 231, 782
BfmI CTRYAG 2 cut(s) 825, 831
BfuI GTATCC 1 cut(s) 152
BglII AGATCT 1 cut(s) 501
BisI GCNGC 9 cut(s) 91, 108, 267, 270, 825, 828, 831, 834, 837
BlpI GCTNAGC 2 cut(s) 111, 351
BlsI GCNGC 9 cut(s) 92, 109, 268, 271, 826, 829, 832, 835, 838
Bme1390I CCNGG 3 cut(s) 218, 663, 705
Bme18I GGWCC 1 cut(s) 494
BmgT120I GGNCC 2 cut(s) 494, 665
BmiI GGNNCC 1 cut(s) 129
BmrFI CCNGG 3 cut(s) 218, 663, 705
BmsI GCATC 1 cut(s) 166
BpiI GAAGAC 1 cut(s) 883
BplI GAGNNNNNCTC 2 cut(s) 119, 151
BpmI CTGGAG 5 cut(s) 137, 526, 576, 672, 726
Bpu10I CCTNAGC 2 cut(s) 180, 273
Bpu1102I GCTNAGC 2 cut(s) 111, 351
BsaHI GRCGYC 1 cut(s) 531
BsaJI CCNNGG 1 cut(s) 703
Bsc4I CCNNNNNNNGG 3 cut(s) 233, 377, 902
Bse1I ACTGG 4 cut(s) 247, 496, 559, 629
BseBI CCWGG 3 cut(s) 218, 663, 705
BseDI CCNNGG 1 cut(s) 703
BseGI GGATG 1 cut(s) 699
BseLI CCNNNNNNNGG 3 cut(s) 233, 377, 902
BseMII CTCAG 2 cut(s) 171, 342
BseNI ACTGG 4 cut(s) 247, 496, 559, 629
BseRI GAGGAG 2 cut(s) 197, 910
BseXI GCAGC 9 cut(s) 77, 94, 256, 278, 811, 817, 823, 839, 845
BseYI CCCAGC 2 cut(s) 575, 896
BshFI GGCC 2 cut(s) 666, 859
BslFI GGGAC 1 cut(s) 565
BslI CCNNNNNNNGG 3 cut(s) 233, 377, 902
BsmFI GGGAC 1 cut(s) 565
BsnI GGCC 2 cut(s) 666, 859
Bsp1286I GDGCHC 1 cut(s) 975
Bsp143I GATC 3 cut(s) 168, 367, 501
Bsp1720I GCTNAGC 2 cut(s) 111, 351
BspACI CCGC 2 cut(s) 372, 946
BspANI GGCC 2 cut(s) 666, 859
BspCNI CTCAG 2 cut(s) 172, 343
BspLI GGNNCC 1 cut(s) 129
BspMAI CTGCAG 2 cut(s) 829, 835
BspPI GGATC 1 cut(s) 362
BsrI ACTGG 4 cut(s) 247, 496, 559, 629
BssECI CCNNGG 1 cut(s) 703
BssMI GATC 3 cut(s) 168, 367, 501
BssNI GRCGYC 1 cut(s) 531
Bst2UI CCWGG 3 cut(s) 218, 663, 705
Bst4CI ACNGT 2 cut(s) 164, 620
Bst6I CTCTTC 1 cut(s) 3
BstACI GRCGYC 1 cut(s) 531
BstAPI GCANNNNNTGC 1 cut(s) 104
BstC8I GCNNGC 3 cut(s) 303, 694, 861
BstDEI CTNAG 4 cut(s) 111, 180, 273, 351
BstF5I GGATG 1 cut(s) 699
BstKTI GATC 3 cut(s) 171, 370, 504
BstMBI GATC 3 cut(s) 168, 367, 501
BstMWI GCNNNNNNNGC 7 cut(s) 23, 104, 243, 263, 830, 833, 836
BstNI CCWGG 3 cut(s) 218, 663, 705
BstSCI CCNGG 3 cut(s) 216, 661, 703
BstSFI CTRYAG 2 cut(s) 825, 831
BstV1I GCAGC 9 cut(s) 77, 94, 256, 278, 811, 817, 823, 839, 845
BstV2I GAAGAC 1 cut(s) 883
BstX2I RGATCY 2 cut(s) 367, 501
BstXI CCANNNNNNTGG 1 cut(s) 504
BstYI RGATCY 2 cut(s) 367, 501
BsuI GTATCC 1 cut(s) 152
BsuRI GGCC 2 cut(s) 666, 859
BtsCI GGATG 1 cut(s) 699
Cac8I GCNNGC 3 cut(s) 303, 694, 861
CaiI CAGNNNCTG 2 cut(s) 179, 575
Cfr13I GGNCC 2 cut(s) 494, 665
CseI GACGC 2 cut(s) 539, 767
Csp6I GTAC 3 cut(s) 476, 561, 583
CviAII CATG 4 cut(s) 77, 298, 382, 961
CviQI GTAC 3 cut(s) 476, 561, 583
DdeI CTNAG 4 cut(s) 111, 180, 273, 351
DpnI GATC 3 cut(s) 170, 369, 503
DpnII GATC 3 cut(s) 168, 367, 501
Eam1104I CTCTTC 1 cut(s) 3
EarI CTCTTC 1 cut(s) 3
Eco24I GRGCYC 1 cut(s) 975
Eco32I GATATC 1 cut(s) 813
Eco47I GGWCC 1 cut(s) 494
Eco57I CTGAAG 1 cut(s) 428
EcoRII CCWGG 3 cut(s) 216, 661, 703
EcoRV GATATC 1 cut(s) 813
EcoT38I GRGCYC 1 cut(s) 975
FaeI CATG 4 cut(s) 80, 301, 385, 964
FaqI GGGAC 1 cut(s) 565
FatI CATG 4 cut(s) 76, 297, 381, 960
FauI CCCGC 2 cut(s) 379, 939
FbaI TGATCA 1 cut(s) 168
FblI GTMKAC 1 cut(s) 528
Fnu4HI GCNGC 9 cut(s) 91, 108, 267, 270, 825, 828, 831, 834, 837
FokI GGATG 1 cut(s) 686
FriOI GRGCYC 1 cut(s) 975
Fsp4HI GCNGC 9 cut(s) 91, 108, 267, 270, 825, 828, 831, 834, 837
FspBI CTAG 3 cut(s) 138, 231, 782
GluI GCNGC 9 cut(s) 91, 108, 267, 270, 825, 828, 831, 834, 837
GsaI CCCAGC 2 cut(s) 579, 900
GsuI CTGGAG 5 cut(s) 137, 526, 576, 672, 726
HaeIII GGCC 2 cut(s) 666, 859
HgaI GACGC 2 cut(s) 539, 767
Hin1I GRCGYC 1 cut(s) 531
Hin1II CATG 4 cut(s) 80, 301, 385, 964
HincII GTYRAC 2 cut(s) 529, 721
HindII GTYRAC 2 cut(s) 529, 721
HinfI GANTC 3 cut(s) 313, 676, 935
HphI GGTGA 2 cut(s) 218, 286
Hpy166II GTNNAC 3 cut(s) 418, 529, 721
Hpy188I TCNGA 1 cut(s) 399
Hpy188III TCNNGA 4 cut(s) 317, 505, 602, 651
Hpy8I GTNNAC 3 cut(s) 418, 529, 721
Hpy99I CGWCG 1 cut(s) 533
HpyAV CCTTC 6 cut(s) 7, 181, 379, 394, 784, 788
HpyCH4III ACNGT 2 cut(s) 164, 620
HpyCH4V TGCA 5 cut(s) 26, 464, 827, 833, 851
HpyF10VI GCNNNNNNNGC 7 cut(s) 23, 104, 243, 263, 830, 833, 836
HpyF3I CTNAG 4 cut(s) 111, 180, 273, 351
Hsp92I GRCGYC 1 cut(s) 531
Hsp92II CATG 4 cut(s) 80, 301, 385, 964
Ksp22I TGATCA 1 cut(s) 168
Kzo9I GATC 3 cut(s) 168, 367, 501
LmnI GCTCC 2 cut(s) 127, 347
Lsp1109I GCAGC 9 cut(s) 77, 94, 256, 278, 811, 817, 823, 839, 845
LweI GCATC 1 cut(s) 166
MaeI CTAG 3 cut(s) 138, 231, 782
MaeIII GTNAC 3 cut(s) 34, 278, 911
MalI GATC 3 cut(s) 170, 369, 503
MboI GATC 3 cut(s) 168, 367, 501
MboII GAAGA 4 cut(s) 20, 326, 767, 883
MfeI CAATTG 1 cut(s) 762
MflI RGATCY 2 cut(s) 367, 501
MhlI GDGCHC 1 cut(s) 975
MluCI AATT 5 cut(s) 41, 449, 684, 726, 762
MlyI GAGTC 1 cut(s) 322
MseI TTAA 2 cut(s) 198, 609
MslI CAYNNNNRTG 1 cut(s) 884
MspA1I CMGCKG 3 cut(s) 269, 830, 836
MspR9I CCNGG 3 cut(s) 218, 663, 705
MunI CAATTG 1 cut(s) 762
MvaI CCWGG 3 cut(s) 218, 663, 705
MwoI GCNNNNNNNGC 7 cut(s) 23, 104, 243, 263, 830, 833, 836
NdeII GATC 3 cut(s) 168, 367, 501
NlaIII CATG 4 cut(s) 80, 301, 385, 964
NlaIV GGNNCC 1 cut(s) 129
PfeI GAWTC 2 cut(s) 676, 935
PkrI GCNGC 9 cut(s) 92, 109, 268, 271, 826, 829, 832, 835, 838
PleI GAGTC 1 cut(s) 321
PpsI GAGTC 1 cut(s) 321
Psp6I CCWGG 3 cut(s) 216, 661, 703
PspFI CCCAGC 2 cut(s) 575, 896
PspGI CCWGG 3 cut(s) 216, 661, 703
PspN4I GGNNCC 1 cut(s) 129
PspPI GGNCC 2 cut(s) 494, 665
PstI CTGCAG 2 cut(s) 829, 835
PstNI CAGNNNCTG 2 cut(s) 179, 575
PsuI RGATCY 2 cut(s) 367, 501
PvuII CAGCTG 3 cut(s) 269, 830, 836
RsaI GTAC 3 cut(s) 477, 562, 584
RsaNI GTAC 3 cut(s) 476, 561, 583
RseI CAYNNNNRTG 1 cut(s) 884
SalI GTCGAC 1 cut(s) 527
SaqAI TTAA 2 cut(s) 198, 609
SatI GCNGC 9 cut(s) 91, 108, 267, 270, 825, 828, 831, 834, 837
Sau3AI GATC 3 cut(s) 168, 367, 501
Sau96I GGNCC 2 cut(s) 494, 665
SchI GAGTC 1 cut(s) 322
ScrFI CCNGG 3 cut(s) 218, 663, 705
SduI GDGCHC 1 cut(s) 975
SfaNI GCATC 1 cut(s) 166
SfcI CTRYAG 2 cut(s) 825, 831
SinI GGWCC 1 cut(s) 494
SmiMI CAYNNNNRTG 1 cut(s) 884
SpeI ACTAGT 1 cut(s) 230
Sse9I AATT 5 cut(s) 41, 449, 684, 726, 762
SsiI CCGC 2 cut(s) 372, 946
SspMI CTAG 3 cut(s) 138, 231, 782
StyD4I CCNGG 3 cut(s) 216, 661, 703
TaaI ACNGT 2 cut(s) 164, 620
TaqI TCGA 3 cut(s) 222, 337, 528
TasI AATT 5 cut(s) 41, 449, 684, 726, 762
TfiI GAWTC 2 cut(s) 676, 935
Tru1I TTAA 2 cut(s) 198, 609
Tru9I TTAA 2 cut(s) 198, 609
TseI GCWGC 9 cut(s) 90, 107, 266, 269, 824, 827, 830, 833, 836
TspDTI ATGAA 4 cut(s) 398, 498, 688, 747
VpaK11BI GGWCC 1 cut(s) 494
XcmI CCANNNNNNNNNTGG 1 cut(s) 83
XmiI GTMKAC 1 cut(s) 528
XspI CTAG 3 cut(s) 138, 231, 782
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.