Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0042623.1

Orthogroup ID

OG0001773

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 3321

Gene Structure 3321 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0042623.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 826 bp

gattggatacagtatgatcacagatgctgaggagaagggtcttattaaggctggtgagagtgtcctggtcgagcctactagtggcaatactggcataggattggcgtttatggcagctgctaagggttacaaactaataatcaccatgcctgcttcaatgagtcttgaaagacgaaccattcttcgaggttttggagctgagcttgttctcacagatcccgccaaaggcatgaagggggctgttcagaaggcacaagagatagtggacaagacacccaatgcttatatgcttcagcaatttgagaaccctgcaaacccaaaggtacattatgaaactactggaccagagatctggagaggctctgctggtaaagtcgacgcctttgtttctgggatagggactggaggtacaataacaggtgctgggaagtacctcaaagagcaaaatcctgatgttaagctctacggtgtagaaccagttgaaagtgctgtcttgtctggagggcgacctggccctcacaagattcaaggaattggtgctggcttcatccctggagttttagatgtcaacctaattgatgaagttatccaaatatcaagtgaagaagcaattgaaacagccaagcgtctagcattgaaggaaggtttgttggtagggatatcatctggtgctgcagctgcagctgctattgagattgcaaggaggccagcaaatgctggaaagctcattgttgtggtcttccccagctttggagagcgttacctctcctctgtattgtttgaatccgtgaagcgggaggcagagaacatggtttttgagccctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00270 ko00920 ko01100 ko01110 ko01120 ko01130 ko01200 ko01230 map00270 map00920 map01100 map01110 map01120 map01130 map01200 map01230

Pfam Domains

Protein Families

PALP

Protein Analysis

274

Amino Acids

28.83

Weight (kDa)

5.64

Isoelectric Point (pI)

35.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001773)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G22460 AT4G14880 AT4G14880 AT4G14880 AT4G14880 AT4G14880
fragaria_vesca	FvH4_4g15640 FvH4_4g15640 FvH4_4g15640 FvH4_4g15640 FvH4_4g15640 FvH4_4g15640 FvH4_4g15640 FvH4_6g03700 FvH4_6g03700 FvH4_6g03700 FvH4_6g03700 FvH4_6g03700
malus_domestica	MD04G1219000.v1.1 MD12G1236000.v1.1 MD13G1193400.v1.1 MD16G1194200.v1.1
prunus_persica	Prupe.1G014000_v2.0.a1 Prupe.6G338400_v2.0.a1 Prupe.6G338400_v2.0.a1
pyrus_communis	pycom04g19440 pycom12g21720 pycom13g16570
rosa_chinensis	RchiOBHm_Chr3g0452241 RchiOBHm_Chr4g0416171
rosa_laevigata	RLG00000008009 RLG00000025614
rosa_multiflora	Rmu_sc0001145.1_g000001 Rmu_sc0010928.1_g000004 Rmu_sc0031164.1_g000006 Rmu_sc0042623.1_g000001
rosa_roxburghii	Rroxscaffold_5G00360030 Rroxscaffold_6G00429370
rosa_rugosa	Rorug02G0639500 Rorug02G0639600 Rorug04G0139300 Rorug04G0139400 Rorug04G0139500
rosa_samantha	Rh3DG042600 Rh4BG199000
rosa_wichuraiana	Rw3G003170 Rw4G017040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	376
AciI	CCGC	2 cut(s)	220, 794
AclWI	GGATC	1 cut(s)	210
AcuI	CTGAAG	1 cut(s)	276
AcyI	GRCGYC	1 cut(s)	379
AfaI	GTAC	3 cut(s)	325, 410, 432
AfiI	CCNNNNNNNGG	4 cut(s)	81, 225, 750, 793
AgsI	TTSAA	7 cut(s)	157, 168, 483, 528, 615, 638, 783
AhlI	ACTAGT	1 cut(s)	78
AjnI	CCWGG	3 cut(s)	64, 509, 551
AluBI	AGCT	8 cut(s)	117, 198, 203, 461, 678, 684, 725, 748
AluI	AGCT	8 cut(s)	117, 198, 203, 461, 678, 684, 725, 748
AlwI	GGATC	1 cut(s)	210
AlwNI	CAGNNNCTG	2 cut(s)	27, 423
AoxI	GGCC	2 cut(s)	512, 705
ApeKI	GCWGC	7 cut(s)	114, 117, 672, 675, 678, 681, 684
AspS9I	GGNCC	2 cut(s)	342, 513
AsuHPI	GGTGA	2 cut(s)	66, 134
AvaII	GGWCC	1 cut(s)	342
BanII	GRGCYC	1 cut(s)	823
BbsI	GAAGAC	1 cut(s)	731
BbvCI	CCTCAGC	1 cut(s)	28
BbvI	GCAGC	7 cut(s)	104, 126, 659, 665, 671, 687, 693
BciT130I	CCWGG	3 cut(s)	66, 511, 553
BclI	TGATCA	1 cut(s)	16
BcuI	ACTAGT	1 cut(s)	78
BfaI	CTAG	2 cut(s)	79, 630
BfmI	CTRYAG	2 cut(s)	673, 679
BglII	AGATCT	1 cut(s)	349
BisI	GCNGC	7 cut(s)	115, 118, 673, 676, 679, 682, 685
BlpI	GCTNAGC	1 cut(s)	199
BlsI	GCNGC	7 cut(s)	116, 119, 674, 677, 680, 683, 686
Bme1390I	CCNGG	3 cut(s)	66, 511, 553
Bme18I	GGWCC	1 cut(s)	342
BmgT120I	GGNCC	2 cut(s)	342, 513
BmrFI	CCNGG	3 cut(s)	66, 511, 553
BmsI	GCATC	1 cut(s)	14
BpiI	GAAGAC	1 cut(s)	731
BpmI	CTGGAG	4 cut(s)	374, 424, 520, 574
Bpu10I	CCTNAGC	2 cut(s)	28, 121
Bpu1102I	GCTNAGC	1 cut(s)	199
BsaHI	GRCGYC	1 cut(s)	379
BsaJI	CCNNGG	1 cut(s)	551
Bsc4I	CCNNNNNNNGG	4 cut(s)	81, 225, 750, 793
Bse1I	ACTGG	4 cut(s)	95, 344, 407, 477
BseBI	CCWGG	3 cut(s)	66, 511, 553
BseDI	CCNNGG	1 cut(s)	551
BseGI	GGATG	1 cut(s)	547
BseLI	CCNNNNNNNGG	4 cut(s)	81, 225, 750, 793
BseMII	CTCAG	2 cut(s)	19, 190
BseNI	ACTGG	4 cut(s)	95, 344, 407, 477
BseRI	GAGGAG	2 cut(s)	45, 758
BseXI	GCAGC	7 cut(s)	104, 126, 659, 665, 671, 687, 693
BseYI	CCCAGC	2 cut(s)	423, 744
BshFI	GGCC	2 cut(s)	514, 707
BslFI	GGGAC	1 cut(s)	413
BslI	CCNNNNNNNGG	4 cut(s)	81, 225, 750, 793
BsmFI	GGGAC	1 cut(s)	413
BsnI	GGCC	2 cut(s)	514, 707
Bsp1286I	GDGCHC	1 cut(s)	823
Bsp143I	GATC	3 cut(s)	16, 215, 349
Bsp1720I	GCTNAGC	1 cut(s)	199
BspACI	CCGC	2 cut(s)	220, 794
BspANI	GGCC	2 cut(s)	514, 707
BspCNI	CTCAG	2 cut(s)	20, 191
BspMAI	CTGCAG	2 cut(s)	677, 683
BspPI	GGATC	1 cut(s)	210
BsrI	ACTGG	4 cut(s)	95, 344, 407, 477
BssECI	CCNNGG	1 cut(s)	551
BssMI	GATC	3 cut(s)	16, 215, 349
BssNI	GRCGYC	1 cut(s)	379
Bst2UI	CCWGG	3 cut(s)	66, 511, 553
Bst4CI	ACNGT	2 cut(s)	12, 468
BstACI	GRCGYC	1 cut(s)	379
BstC8I	GCNNGC	3 cut(s)	151, 542, 709
BstDEI	CTNAG	3 cut(s)	28, 121, 199
BstF5I	GGATG	1 cut(s)	547
BstKTI	GATC	3 cut(s)	19, 218, 352
BstMBI	GATC	3 cut(s)	16, 215, 349
BstMWI	GCNNNNNNNGC	5 cut(s)	91, 111, 678, 681, 684
BstNI	CCWGG	3 cut(s)	66, 511, 553
BstSCI	CCNGG	3 cut(s)	64, 509, 551
BstSFI	CTRYAG	2 cut(s)	673, 679
BstV1I	GCAGC	7 cut(s)	104, 126, 659, 665, 671, 687, 693
BstV2I	GAAGAC	1 cut(s)	731
BstX2I	RGATCY	2 cut(s)	215, 349
BstXI	CCANNNNNNTGG	1 cut(s)	352
BstYI	RGATCY	2 cut(s)	215, 349
BsuRI	GGCC	2 cut(s)	514, 707
BtsCI	GGATG	1 cut(s)	547
Cac8I	GCNNGC	3 cut(s)	151, 542, 709
CaiI	CAGNNNCTG	2 cut(s)	27, 423
Cfr13I	GGNCC	2 cut(s)	342, 513
CseI	GACGC	2 cut(s)	387, 615
Csp6I	GTAC	3 cut(s)	324, 409, 431
CviAII	CATG	3 cut(s)	146, 230, 809
CviQI	GTAC	3 cut(s)	324, 409, 431
DdeI	CTNAG	3 cut(s)	28, 121, 199
DpnI	GATC	3 cut(s)	18, 217, 351
DpnII	GATC	3 cut(s)	16, 215, 349
Eco24I	GRGCYC	1 cut(s)	823
Eco32I	GATATC	1 cut(s)	661
Eco47I	GGWCC	1 cut(s)	342
Eco57I	CTGAAG	1 cut(s)	276
EcoRII	CCWGG	3 cut(s)	64, 509, 551
EcoRV	GATATC	1 cut(s)	661
EcoT38I	GRGCYC	1 cut(s)	823
FaeI	CATG	3 cut(s)	149, 233, 812
FaiI	YATR	9 cut(s)	15, 96, 111, 147, 231, 286, 288, 331, 810
FaqI	GGGAC	1 cut(s)	413
FatI	CATG	3 cut(s)	145, 229, 808
FauI	CCCGC	2 cut(s)	227, 787
FbaI	TGATCA	1 cut(s)	16
FblI	GTMKAC	1 cut(s)	376
Fnu4HI	GCNGC	7 cut(s)	115, 118, 673, 676, 679, 682, 685
FokI	GGATG	1 cut(s)	534
FriOI	GRGCYC	1 cut(s)	823
Fsp4HI	GCNGC	7 cut(s)	115, 118, 673, 676, 679, 682, 685
FspBI	CTAG	2 cut(s)	79, 630
GluI	GCNGC	7 cut(s)	115, 118, 673, 676, 679, 682, 685
GsaI	CCCAGC	2 cut(s)	427, 748
GsuI	CTGGAG	4 cut(s)	374, 424, 520, 574
HaeIII	GGCC	2 cut(s)	514, 707
HgaI	GACGC	2 cut(s)	387, 615
Hin1I	GRCGYC	1 cut(s)	379
Hin1II	CATG	3 cut(s)	149, 233, 812
HincII	GTYRAC	2 cut(s)	377, 569
HindII	GTYRAC	2 cut(s)	377, 569
HinfI	GANTC	3 cut(s)	161, 524, 783
HphI	GGTGA	2 cut(s)	66, 134
Hpy166II	GTNNAC	3 cut(s)	266, 377, 569
Hpy188I	TCNGA	1 cut(s)	247
Hpy188III	TCNNGA	4 cut(s)	165, 353, 450, 499
Hpy8I	GTNNAC	3 cut(s)	266, 377, 569
Hpy99I	CGWCG	1 cut(s)	381
HpyAV	CCTTC	5 cut(s)	29, 227, 242, 632, 636
HpyCH4III	ACNGT	2 cut(s)	12, 468
HpyCH4V	TGCA	4 cut(s)	312, 675, 681, 699
HpyF10VI	GCNNNNNNNGC	5 cut(s)	91, 111, 678, 681, 684
HpyF3I	CTNAG	3 cut(s)	28, 121, 199
Hsp92I	GRCGYC	1 cut(s)	379
Hsp92II	CATG	3 cut(s)	149, 233, 812
Ksp22I	TGATCA	1 cut(s)	16
Kzo9I	GATC	3 cut(s)	16, 215, 349
LmnI	GCTCC	1 cut(s)	195
Lsp1109I	GCAGC	7 cut(s)	104, 126, 659, 665, 671, 687, 693
LweI	GCATC	1 cut(s)	14
MaeI	CTAG	2 cut(s)	79, 630
MaeIII	GTNAC	2 cut(s)	126, 759
MalI	GATC	3 cut(s)	18, 217, 351
MboI	GATC	3 cut(s)	16, 215, 349
MboII	GAAGA	3 cut(s)	174, 615, 731
MfeI	CAATTG	1 cut(s)	610
MflI	RGATCY	2 cut(s)	215, 349
MhlI	GDGCHC	1 cut(s)	823
MluCI	AATT	4 cut(s)	297, 532, 574, 610
MlyI	GAGTC	1 cut(s)	170
MseI	TTAA	2 cut(s)	46, 457
MslI	CAYNNNNRTG	1 cut(s)	732
MspA1I	CMGCKG	3 cut(s)	117, 678, 684
MspR9I	CCNGG	3 cut(s)	66, 511, 553
MunI	CAATTG	1 cut(s)	610
MvaI	CCWGG	3 cut(s)	66, 511, 553
MwoI	GCNNNNNNNGC	5 cut(s)	91, 111, 678, 681, 684
NdeII	GATC	3 cut(s)	16, 215, 349
NlaIII	CATG	3 cut(s)	149, 233, 812
PfeI	GAWTC	2 cut(s)	524, 783
PkrI	GCNGC	7 cut(s)	116, 119, 674, 677, 680, 683, 686
PleI	GAGTC	1 cut(s)	169
PpsI	GAGTC	1 cut(s)	169
Psp6I	CCWGG	3 cut(s)	64, 509, 551
PspFI	CCCAGC	2 cut(s)	423, 744
PspGI	CCWGG	3 cut(s)	64, 509, 551
PspPI	GGNCC	2 cut(s)	342, 513
PstI	CTGCAG	2 cut(s)	677, 683
PstNI	CAGNNNCTG	2 cut(s)	27, 423
PsuI	RGATCY	2 cut(s)	215, 349
PvuII	CAGCTG	3 cut(s)	117, 678, 684
RsaI	GTAC	3 cut(s)	325, 410, 432
RsaNI	GTAC	3 cut(s)	324, 409, 431
RseI	CAYNNNNRTG	1 cut(s)	732
SalI	GTCGAC	1 cut(s)	375
SaqAI	TTAA	2 cut(s)	46, 457
SatI	GCNGC	7 cut(s)	115, 118, 673, 676, 679, 682, 685
Sau3AI	GATC	3 cut(s)	16, 215, 349
Sau96I	GGNCC	2 cut(s)	342, 513
SchI	GAGTC	1 cut(s)	170
ScrFI	CCNGG	3 cut(s)	66, 511, 553
SduI	GDGCHC	1 cut(s)	823
SfaNI	GCATC	1 cut(s)	14
SfcI	CTRYAG	2 cut(s)	673, 679
SinI	GGWCC	1 cut(s)	342
SmiMI	CAYNNNNRTG	1 cut(s)	732
SpeI	ACTAGT	1 cut(s)	78
Sse9I	AATT	4 cut(s)	297, 532, 574, 610
SsiI	CCGC	2 cut(s)	220, 794
SspMI	CTAG	2 cut(s)	79, 630
StyD4I	CCNGG	3 cut(s)	64, 509, 551
TaaI	ACNGT	2 cut(s)	12, 468
TaqI	TCGA	3 cut(s)	70, 185, 376
TasI	AATT	4 cut(s)	297, 532, 574, 610
TfiI	GAWTC	2 cut(s)	524, 783
Tru1I	TTAA	2 cut(s)	46, 457
Tru9I	TTAA	2 cut(s)	46, 457
TseI	GCWGC	7 cut(s)	114, 117, 672, 675, 678, 681, 684
TspDTI	ATGAA	4 cut(s)	246, 346, 536, 595
TspGWI	ACGGA	1 cut(s)	776
VpaK11BI	GGWCC	1 cut(s)	342
XmiI	GTMKAC	1 cut(s)	376
XspI	CTAG	2 cut(s)	79, 630

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.