Rmu_sc0011951.1_g000004

Helicase associated domain (HA2) Add an annotation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011951.1
Physical Location & Seq
Reverse (-)
7193 .. 13312
6120 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011951.1_g000004.1.cds

Sequence Viewer

Length: 5163 bp
atgaggggatcaaagccggccggaatgtcgtggccgcaggctgagcagcgacgattttatccgcaaccagggtcccacccacgcgccgccgtcccgcgacggccggtgcctcgaattcagcggccgaatttcatcgtttatcttctgtccgacaaacgggaccaccgggggtcggacatcgaggcggtgatcaaccagtgcagggcgaagccggagaatttccgggtgagtccggagaacaacacagtcgcgtcgatgttctacgcgcagtggtacgacgcgctcgaagcgatggtctggctgtgggagtcgcggctcgaccgggttcacaatttcacgcccaagcttgacgccaacgactccgtctccacgccgtccgatagcgtggagctggaggaccgcctgagaaccttgttcgccggccgaattaagcagttaatcgacggcgacgaggtgaagaagtgtgaagcaaagcgccaaattttggccagagagtacgaccgagttcgtaagctggccaagaagcctcagaggaattgggaggacttaccggagaaggagaagaggtgcagagttgagcttgaattggttgagagtaggatcagagagttcaggtctgctatgaactgcttgcttgctcgtgttgaagggaaagagttggaggagtatggtgaagaaggcgtgaagctgtttaaattcggcgaaatttggcattggagtcgaattcagaggttaatggtgagggagtgtcgccgactcgatgagggattgcccatttatgctcataggcagcaaattcttgagcagattactaatcagcaggtcatggtgttgattggagagactggttcggggaagagtacacaattggttcagtttcttgctgattctggaatcgctgctgataagtccattgtatgcactcagcctcgcaagattgctgccaattcattggcaaagagagtcaaggaagaaagtagtgggtgttactatggagaaaacacagttaccagttatcagacatcgtctggactgcagttgacttctaaggtaacatatatgacagaccactgtttactgcagtactacatgaaagatagaaatatgaccatgatttcttgcatcatagttgatgaggctcatgaaaggaccttgagtacagatctccttttagcattgatcaaagatttactgggtcgaaggcatcagttaaggcttataataatgtctgcaacagctgatgcagaagtgctttcacattattttttcaactgtaaaatctttcatgtagtggggaggaactttccagttgatgtaagatatgctccctctttcactgacggaactgccagtaatgttgcttcttatgtttctgatgtgatgagggtagcaagagagatccacaagaatgagaaagaagggacaattcttgcatttttgacttctcagatggaagtcgaatgggtctgcgagaagtttataacacctggtgcaattgcattgccattgcatgggaaactttcttttgaagaacaatctaatgtttttcaaaatcaccctgggaaaagaaaaattatattcgccacaaatctggcggagacatccctgacaattcctggggtaaagtatgtgattgattctggcatggtcaaagaaagcaaatttgaacctggaagtggtatgaatgttctcagagtttgcaggatcagccagagttctgctaagcaaagaactgggcgtgctggaagaacggaacctggaatatgttatagactctactcagaatatgattttcaggcgatgcctccatgtcaggagcccgagatccgtagagttcatcttggtgtagcagttctgaggattctggctttgggtgtcaagaatttaaaagagtttgaattcattgatgcaccttgttctgaagctatagacatggcaatgaggaatcttgttcagttaggagctgttaagcaaaacaatgatgtctatgaactaactcaagagggtcgcgacttggttaaattgggggttgagcctaggcttggtaaattaattcttggctgctatcaccataacttgcgtaaggagggccttgttcttgcggctgtaatggcaaatgcaagtagcatattttgcagagttggtaatgacgaggagaaacttaggtcagactgcttcaaggtgcaattttgccatcgtgatggtgacctctttacccttctatcagtgtacaagatatgggaagctctgcctcgagagaggagaaacacatggtgttgggaaaacagcatcaatgccaaaactatgaggagatgccaggacactgtatcagaattggagttttgccttaaacatgagctcaataggataattccttgtagctggcgttggaatgcgcatgtttcaactgattgtgatatatacttgaaaaaggttatactttcttccctggcagaaaatgtagcaatgttctcaggatatgatcaagttggttatgaggtggcattaactgggcagcatgttcggctgcacccttcttgttcattgctggtattcggccagaaacctagttgggttgtttttggtgaactcctctcaagttctaatcaatatttggcctgtgtcactaccattgattttaactctttgtctacccttgatccccctcctgtgtttgatgtgtccaagatggaaggtcgaaagttgcaactgaaagtgttgactggttttggcagttgtttgcttaaaagattttgtgggaagggcaacaattatctgcatcatcttgtatctcgtgtcaggacaatttgcaatgatgaacttatcagcattaaagtcgattattgtcagaatgagattatggtgtttgctaccccacataacatggatagggttataaaccttgtatccgatgcattggagtgtgaaaaaagatggctgcgtaatgaatgcttggagaaatgcttgtatcatggttctggtggcttgcctcctgtagcattgtttggggctggtgcagagatcaagcatctggagcttcataaaaggtgtttgactgttgatgtatttcattcaaaactggatgacatggatgataaggagtttcttactgagcttgaagagtctgcctctggtagtatctgtggtcatcataagttccccggcactgggcaggaaaatgttgacaaaggaaagggggccaggttgacatttcttactcctgatgctgctcagaaagctgttgaattaaatgattctgagtttaatggttctatactgaaggttgttccttcacaggttggaggtgatcataaggtctatccactccttgctgttagagctaaaattttatggcctcgcaggcaaagccatgggtttgcaattgttaaatgtgacatggatgatatttaccccatgcttgctgatttttctaaccttgtagttggaggaagaaatattcgttgtcagcctagcaaaagatacacgtccgactctgttgtgattagtggactaaacagagatctttctgagaaagaaatccttgatgtgttaaggactgctactagtaggacaatcctggatttttttctggtgagaggggatgctgtagaaaatccgccatgtggtgcatgtgaagaagcactgctaaaagaaatatcaccctatatgcctaaacggtactcccatagtagctgcactgttcaggttttccagcctgaaccaaagaatcatttcatgagagctttgataacatttgacggaagattacacttggaggcagcaaaggctttagaacaattggaagggaaagtattgcccggcttccttccatggcaaaagatggagtgtcagcagttatttcatagctctctgtcctgccctggccctgtttatcgtgtaataaagaagcagctagatcctttacttgaaagttttacgcatctaaaaggtgtagaatgtaatctcgaggagtatcctaatggttcctgcagagttaagatatcagccaatgctacaaaaacgattgctgatctgaggagacgtgtggaggagcttgtgagggggaagactatagaccacccaagcctcactgcaactgttttgcagcttctgttttccagagatggcaccagtctaatgaactcgttacagcgagagacaggaacatatatcatttttgacaggcacaaactcaatgtacaggtctttggtgaagcacataaagttgacatggtcaagcagaaattggttgaatcccttttaaacctccatgaaagcaaggtgcttgagatccgccttcaaggtaatgctttacctcctgagttgatgaaagaggttgttagaaggtttgggccagacctccgggggctcaaagagaaggtaccaggggctgattttactctaaatgtacgccgtcaatccattctcatctacggaagcaaggagttgaagcaaaaagttgaagagattattgatgatactgcacatatggctggtagtttgactaagaggataaatagggaagctgattgtccaatctgcttgtgtgatgttgaagacggttaccggctggaggactgtggtcacttgttttgtcgttcatgtttggtggagcagtgcgagtctgcaatcaataatcatgatagctttccattatgctgcactcatgagggttgcaggtctccaattttgatcacagatctcagatctcttttatcaattgagaagctggaagatctctttagggcttcggtggggtcatatgttgcttcaagttgtggcacctacaggttttgcccatctcccgactgcgcttcagtctatcaggtagcggctcctggaacagaaggtgaaccatttgtttgtggtgcatgttatgcggagacgtgtaccatgtgccatttagaacatcatccttacatgtcatgcaagcagtacaagaatttcaaggaagatccggattcttcattgaaggagtggtgcaaaggaaaagaacatgtgaagagctgcccggtttgcagatatacaattgagaagatagatgggtgcaaccatatagaatgtcggtgcgggaagcatatttgctgggtttgtttggcctattatggaagcagcgatgaatgttatggccacttgagaagtgttcacctggcaatcatttga

Protein Analysis

1720

Amino Acids

194.91

Weight (kDa)

7.86

Isoelectric Point (pI)

46.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 3 cut(s) 1220, 1481, 2897
Acc16I TGCGCA 1 cut(s) 2397
Acc36I ACCTGC 2 cut(s) 811, 4668
Acc65I GGTACC 1 cut(s) 4381
AccB1I GGYRCC 4 cut(s) 106, 4127, 4381, 4781
AccB7I CCANNNNNTGG 2 cut(s) 484, 1511
AccI GTMKAC 1 cut(s) 2651
AccII CGCG 7 cut(s) 84, 97, 251, 266, 281, 313, 2010
AccIII TCCGGA 2 cut(s) 232, 4957
AclWI GGATC 9 cut(s) 16, 608, 1393, 1712, 1819, 2654, 3911, 4285, 4949
AcoI YGGCCR 9 cut(s) 18, 32, 101, 122, 421, 486, 516, 2557, 5128
AcuI CTGAAG 3 cut(s) 1941, 3299, 4800
AcyI GRCGYC 1 cut(s) 351
AdeI CACNNNGTG 2 cut(s) 1490, 2274
AflIII ACRYGT 5 cut(s) 3483, 4042, 4886, 4920, 4996
AhlI ACTAGT 1 cut(s) 3563
AjiI CACGTC 3 cut(s) 3486, 4043, 4887
Alw21I GWGCWC 1 cut(s) 2361
Alw26I GTCTC 7 cut(s) 370, 836, 1592, 4033, 4151, 4686, 4877
AlwI GGATC 9 cut(s) 16, 608, 1393, 1712, 1819, 2654, 3911, 4285, 4949
AlwNI CAGNNNCTG 2 cut(s) 4111, 4391
Ama87I CYCGRG 3 cut(s) 1820, 2253, 3965
Aor13HI TCCGGA 2 cut(s) 232, 4957
ArsI GACNNNNNNTTYG 2 cut(s) 279, 311
AseI ATTAAT 1 cut(s) 2051
Asp700I GAANNNNTTC 1 cut(s) 3731
Asp718I GGTACC 1 cut(s) 4381
AspA2I CCTAGG 1 cut(s) 2036
AspLEI GCGC 6 cut(s) 86, 268, 283, 477, 2398, 4814
AspS9I GGNCC 8 cut(s) 72, 160, 397, 1149, 2089, 3198, 3884, 4352
AsuC2I CCSGG 7 cut(s) 167, 224, 323, 3162, 3819, 4364, 5012
AvaI CYCGRG 3 cut(s) 1820, 2253, 3965
AvaII GGWCC 4 cut(s) 72, 160, 397, 1149
AvrII CCTAGG 1 cut(s) 2036
BalI TGGCCA 3 cut(s) 488, 518, 5130
BanI GGYRCC 4 cut(s) 106, 4127, 4381, 4781
BanII GRGCYC 3 cut(s) 1821, 2361, 4371
BarI GAAGNNNNNNTAC 2 cut(s) 1345, 1377
BauI CACGAG 2 cut(s) 639, 2793
BbsI GAAGAC 2 cut(s) 4073, 4563
Bbv12I GWGCWC 1 cut(s) 2361
BceAI ACGGC 5 cut(s) 74, 116, 358, 460, 4398
BcgI CGANNNNNNTGC 6 cut(s) 701, 735, 2504, 2538, 2818, 2852
BciVI GTATCC 2 cut(s) 2917, 3984
BclI TGATCA 5 cut(s) 189, 1179, 2482, 3307, 4692
BcnI CCSGG 7 cut(s) 167, 224, 323, 3162, 3819, 4364, 5012
BcoDI GTCTC 7 cut(s) 370, 836, 1592, 4033, 4151, 4686, 4877
BcuI ACTAGT 1 cut(s) 3563
BfaI CTAG 5 cut(s) 2037, 2568, 3471, 3564, 3914
BfmI CTRYAG 8 cut(s) 1034, 1079, 1926, 2994, 3606, 3988, 4071, 4786
BfoI RGCGCY 1 cut(s) 478
BfuAI ACCTGC 2 cut(s) 811, 4668
BfuI GTATCC 2 cut(s) 2917, 3984
BglI GCCNNNNNGGC 1 cut(s) 3361
BglII AGATCT 5 cut(s) 1162, 3520, 4699, 4706, 4735
BlnI CCTAGG 1 cut(s) 2036
BlpI GCTNAGC 2 cut(s) 42, 1722
BmcAI AGTACT 1 cut(s) 1085
Bme18I GGWCC 4 cut(s) 72, 160, 397, 1149
BmeT110I CYCGRG 3 cut(s) 1820, 2253, 3965
BmgBI CACGTC 3 cut(s) 3486, 4043, 4887
BmgT120I GGNCC 8 cut(s) 72, 160, 397, 1149, 2089, 3198, 3884, 4352
BmrI ACTGGG 4 cut(s) 1202, 1743, 2520, 3177
BmuI ACTGGG 4 cut(s) 1202, 1743, 2520, 3177
BoxI GACNNNNGTC 1 cut(s) 4581
BpiI GAAGAC 2 cut(s) 4073, 4563
BplI GAGNNNNNCTC 2 cut(s) 3113, 3145
BpmI CTGGAG 3 cut(s) 413, 3053, 4592
Bpu1102I GCTNAGC 2 cut(s) 42, 1722
BpuEI CTTGAG 6 cut(s) 821, 1174, 1983, 2581, 4307, 5155
BpuMI CCSGG 7 cut(s) 167, 224, 323, 3162, 3819, 4364, 5012
BsaHI GRCGYC 1 cut(s) 351
BsaI GGTCTC 1 cut(s) 4686
BsaWI WCCGGW 3 cut(s) 232, 550, 4957
BsaXI ACNNNNNCTCC 4 cut(s) 350, 380, 551, 581
Bse118I RCCGGY 4 cut(s) 16, 103, 419, 4566
Bse3DI GCAATG 6 cut(s) 1499, 1505, 1944, 2472, 2543, 2818
BseAI TCCGGA 2 cut(s) 232, 4957
BseGI GGATG 6 cut(s) 1601, 3088, 3097, 3406, 3607, 4912
BseMI GCAATG 6 cut(s) 1499, 1505, 1944, 2472, 2543, 2818
BseRI GAGGAG 8 cut(s) 677, 2168, 2275, 2323, 2582, 3983, 4051, 4064
BseX3I CGGCCG 4 cut(s) 18, 101, 122, 421
BseYI CCCAGC 1 cut(s) 5085
BsgI GTGCAG 7 cut(s) 220, 589, 2513, 3036, 3679, 4467, 4645
Bsh1236I CGCG 7 cut(s) 84, 97, 251, 266, 281, 313, 2010
Bsh1285I CGRYCG 6 cut(s) 21, 104, 125, 322, 424, 502
BshNI GGYRCC 4 cut(s) 106, 4127, 4381, 4781
BsiEI CGRYCG 6 cut(s) 21, 104, 125, 322, 424, 502
BsiHKAI GWGCWC 1 cut(s) 2361
BsiHKCI CYCGRG 3 cut(s) 1820, 2253, 3965
BslFI GGGAC 4 cut(s) 58, 77, 173, 1435
BsmAI GTCTC 7 cut(s) 370, 836, 1592, 4033, 4151, 4686, 4877
BsmBI CGTCTC 3 cut(s) 370, 4033, 4877
BsmFI GGGAC 4 cut(s) 58, 77, 173, 1435
BsmI GAATGC 2 cut(s) 2398, 2954
Bso31I GGTCTC 1 cut(s) 4686
BsoBI CYCGRG 3 cut(s) 1820, 2253, 3965
Bsp1286I GDGCHC 3 cut(s) 1821, 2361, 4371
Bsp13I TCCGGA 2 cut(s) 232, 4957
Bsp1407I TGTACA 2 cut(s) 2229, 4198
Bsp1720I GCTNAGC 2 cut(s) 42, 1722
Bsp19I CCATGG 2 cut(s) 3370, 3830
Bsp68I TCGCGA 1 cut(s) 2010
BspEI TCCGGA 2 cut(s) 232, 4957
BspFNI CGCG 7 cut(s) 84, 97, 251, 266, 281, 313, 2010
BspHI TCATGA 4 cut(s) 1141, 3735, 4639, 4666
BspMAI CTGCAG 3 cut(s) 1038, 1083, 3992
BspMI ACCTGC 2 cut(s) 811, 4668
BspPI GGATC 9 cut(s) 16, 608, 1393, 1712, 1819, 2654, 3911, 4285, 4949
BspQI GCTCTTC 1 cut(s) 4997
BspT107I GGYRCC 4 cut(s) 106, 4127, 4381, 4781
BspTNI GGTCTC 1 cut(s) 4686
BsrDI GCAATG 6 cut(s) 1499, 1505, 1944, 2472, 2543, 2818
BsrFI RCCGGY 4 cut(s) 16, 103, 419, 4566
BsrGI TGTACA 2 cut(s) 2229, 4198
BssAI RCCGGY 4 cut(s) 16, 103, 419, 4566
BssNI GRCGYC 1 cut(s) 351
BssSI CACGAG 2 cut(s) 639, 2793
BssT1I CCWWGG 3 cut(s) 2036, 3370, 3830
Bst2BI CACGAG 2 cut(s) 639, 2793
Bst6I CTCTTC 5 cut(s) 557, 851, 3114, 4458, 4997
BstACI GRCGYC 1 cut(s) 351
BstAPI GCANNNNNTGC 2 cut(s) 2133, 4877
BstAUI TGTACA 2 cut(s) 2229, 4198
BstDSI CCRYGG 2 cut(s) 3370, 3830
BstEII GGTNACC 2 cut(s) 2204, 4562
BstF5I GGATG 6 cut(s) 1601, 3088, 3097, 3406, 3607, 4912
BstFNI CGCG 7 cut(s) 84, 97, 251, 266, 281, 313, 2010
BstH2I RGCGCY 1 cut(s) 478
BstHHI GCGC 6 cut(s) 86, 268, 283, 477, 2398, 4814
BstMAI GTCTC 7 cut(s) 370, 836, 1592, 4033, 4151, 4686, 4877
BstMCI CGRYCG 6 cut(s) 21, 104, 125, 322, 424, 502
BstNSI RCATGY 6 cut(s) 2402, 2522, 3633, 4875, 4924, 5000
BstPAI GACNNNNGTC 1 cut(s) 4581
BstPI GGTNACC 2 cut(s) 2204, 4562
BstSFI CTRYAG 8 cut(s) 1034, 1079, 1926, 2994, 3606, 3988, 4071, 4786
BstUI CGCG 7 cut(s) 84, 97, 251, 266, 281, 313, 2010
BstV2I GAAGAC 2 cut(s) 4073, 4563
BstXI CCANNNNNNTGG 3 cut(s) 952, 1591, 2201
BstZI CGGCCG 4 cut(s) 18, 101, 122, 421
BsuI GTATCC 2 cut(s) 2917, 3984
BtgI CCRYGG 2 cut(s) 3370, 3830
BtgZI GCGATG 3 cut(s) 305, 1814, 5130
BtrI CACGTC 3 cut(s) 3486, 4043, 4887
BtsCI GGATG 6 cut(s) 1601, 3088, 3097, 3406, 3607, 4912
BtsI GCAGTG 4 cut(s) 275, 3641, 4089, 4622
BtuMI TCGCGA 1 cut(s) 2010
BveI ACCTGC 2 cut(s) 811, 4668
CaiI CAGNNNCTG 2 cut(s) 4111, 4391
CciI TCATGA 4 cut(s) 1141, 3735, 4639, 4666
CfoI GCGC 6 cut(s) 86, 268, 283, 477, 2398, 4814
Cfr10I RCCGGY 4 cut(s) 16, 103, 419, 4566
Cfr13I GGNCC 8 cut(s) 72, 160, 397, 1149, 2089, 3198, 3884, 4352
CseI GACGC 3 cut(s) 240, 287, 359
CsiI ACCWGGT 1 cut(s) 1486
DraI TTTAAA 3 cut(s) 694, 1887, 4263
DraIII CACNNNGTG 2 cut(s) 1490, 2274
EaeI YGGCCR 9 cut(s) 18, 32, 101, 122, 421, 486, 516, 2557, 5128
EagI CGGCCG 4 cut(s) 18, 101, 122, 421
Eam1104I CTCTTC 5 cut(s) 557, 851, 3114, 4458, 4997
EarI CTCTTC 5 cut(s) 557, 851, 3114, 4458, 4997
EciI GGCGGA 3 cut(s) 1610, 3606, 4283
Ecl136II GAGCTC 1 cut(s) 2359
EclXI CGGCCG 4 cut(s) 18, 101, 122, 421
Eco130I CCWWGG 3 cut(s) 2036, 3370, 3830
Eco24I GRGCYC 3 cut(s) 1821, 2361, 4371
Eco31I GGTCTC 1 cut(s) 4686
Eco32I GATATC 1 cut(s) 4002
Eco47I GGWCC 4 cut(s) 72, 160, 397, 1149
Eco52I CGGCCG 4 cut(s) 18, 101, 122, 421
Eco53kI GAGCTC 1 cut(s) 2359
Eco57I CTGAAG 3 cut(s) 1941, 3299, 4800
Eco88I CYCGRG 3 cut(s) 1820, 2253, 3965
Eco91I GGTNACC 2 cut(s) 2204, 4562
EcoICRI GAGCTC 1 cut(s) 2359
EcoO109I RGGNCCY 3 cut(s) 72, 1149, 2089
EcoO65I GGTNACC 2 cut(s) 2204, 4562
EcoRI GAATTC 3 cut(s) 114, 723, 1898
EcoRV GATATC 1 cut(s) 4002
EcoT14I CCWWGG 3 cut(s) 2036, 3370, 3830
EcoT22I ATGCAT 1 cut(s) 2917
EcoT38I GRGCYC 3 cut(s) 1821, 2361, 4371
ErhI CCWWGG 3 cut(s) 2036, 3370, 3830
Esp3I CGTCTC 3 cut(s) 370, 4033, 4877
FalI AAGNNNNNCTT 2 cut(s) 3525, 3557
FaqI GGGAC 4 cut(s) 58, 77, 173, 1435
FauI CCCGC 2 cut(s) 102, 5063
FauNDI CATATG 2 cut(s) 4488, 4762
FbaI TGATCA 5 cut(s) 189, 1179, 2482, 3307, 4692
FblI GTMKAC 1 cut(s) 2651
FokI GGATG 6 cut(s) 1588, 3095, 3104, 3413, 3614, 4899
FriOI GRGCYC 3 cut(s) 1821, 2361, 4371
FspAI RTGCGCAY 1 cut(s) 2397
FspBI CTAG 5 cut(s) 2037, 2568, 3471, 3564, 3914
FspI TGCGCA 1 cut(s) 2397
GlaI GCGC 6 cut(s) 85, 267, 282, 476, 2397, 4813
GsaI CCCAGC 1 cut(s) 5089
GsuI CTGGAG 3 cut(s) 413, 3053, 4592
HaeII RGCGCY 1 cut(s) 478
HgaI GACGC 3 cut(s) 240, 287, 359
HhaI GCGC 6 cut(s) 86, 268, 283, 477, 2398, 4814
Hin1I GRCGYC 1 cut(s) 351
Hin6I GCGC 6 cut(s) 84, 266, 281, 475, 2396, 4812
HinP1I GCGC 6 cut(s) 84, 266, 281, 475, 2396, 4812
HincII GTYRAC 5 cut(s) 1041, 2721, 3184, 3207, 4228
HindII GTYRAC 5 cut(s) 1041, 2721, 3184, 3207, 4228
HindIII AAGCTT 1 cut(s) 344
Hpy99I CGWCG 6 cut(s) 54, 102, 256, 281, 446, 452
HpyCH4IV ACGT 3 cut(s) 3485, 4042, 4886
HpySE526I ACGT 3 cut(s) 3485, 4042, 4886
Hsp92I GRCGYC 1 cut(s) 351
HspAI GCGC 6 cut(s) 84, 266, 281, 475, 2396, 4812
KflI GGGWCCC 1 cut(s) 72
Kpn2I TCCGGA 2 cut(s) 232, 4957
KpnI GGTACC 1 cut(s) 4385
KroI GCCGGC 2 cut(s) 16, 419
KroNI GCCGGC 2 cut(s) 18, 421
Ksp22I TGATCA 5 cut(s) 189, 1179, 2482, 3307, 4692
LguI GCTCTTC 1 cut(s) 4997
LmnI GCTCC 8 cut(s) 388, 1330, 1816, 1961, 3034, 4051, 4612, 4840
MabI ACCWGGT 1 cut(s) 1486
MaeI CTAG 5 cut(s) 2037, 2568, 3471, 3564, 3914
MaeII ACGT 3 cut(s) 3485, 4042, 4886
MaeIII GTNAC 9 cut(s) 986, 1006, 1051, 2204, 2623, 3392, 4146, 4562, 4583
MfeI CAATTG 6 cut(s) 866, 1494, 3381, 3797, 4719, 5028
MhlI GDGCHC 3 cut(s) 1821, 2361, 4371
MlsI TGGCCA 3 cut(s) 488, 518, 5130
MluNI TGGCCA 3 cut(s) 488, 518, 5130
MmeI TCCRAC 7 cut(s) 153, 174, 639, 2369, 3280, 3424, 3513
Mox20I TGGCCA 3 cut(s) 488, 518, 5130
Mph1103I ATGCAT 1 cut(s) 2917
MroI TCCGGA 2 cut(s) 232, 4957
MroNI GCCGGC 2 cut(s) 16, 419
MroXI GAANNNNTTC 1 cut(s) 3731
MscI TGGCCA 3 cut(s) 488, 518, 5130
MslI CAYNNNNRTG 5 cut(s) 1407, 1842, 1937, 2199, 2920
Msp20I TGGCCA 3 cut(s) 488, 518, 5130
MspA1I CMGCKG 2 cut(s) 121, 1238
MunI CAATTG 6 cut(s) 866, 1494, 3381, 3797, 4719, 5028
Mva1269I GAATGC 2 cut(s) 2398, 2954
MvnI CGCG 7 cut(s) 84, 97, 251, 266, 281, 313, 2010
NaeI GCCGGC 2 cut(s) 18, 421
NciI CCSGG 7 cut(s) 167, 224, 323, 3162, 3819, 4364, 5012
NcoI CCATGG 2 cut(s) 3370, 3830
NdeI CATATG 2 cut(s) 4488, 4762
NgoMIV GCCGGC 2 cut(s) 16, 419
NmuCI GTSAC 4 cut(s) 2204, 2623, 3392, 4583
NruI TCGCGA 1 cut(s) 2010
NsbI TGCGCA 1 cut(s) 2397
NsiI ATGCAT 1 cut(s) 2917
NspI RCATGY 6 cut(s) 2402, 2522, 3633, 4875, 4924, 5000
PaeR7I CTCGAG 2 cut(s) 2253, 3965
PagI TCATGA 4 cut(s) 1141, 3735, 4639, 4666
PasI CCCWGGG 1 cut(s) 1559
PciI ACATGT 2 cut(s) 4920, 4996
PciSI GCTCTTC 1 cut(s) 4997
PcsI WCGNNNNNNNCGW 2 cut(s) 282, 447
PctI GAATGC 2 cut(s) 2398, 2954
PdiI GCCGGC 2 cut(s) 18, 421
PdmI GAANNNNTTC 1 cut(s) 3731
PfeI GAWTC 9 cut(s) 887, 894, 1637, 1861, 1945, 3254, 3727, 4253, 4961
PflFI GACNNNGTC 3 cut(s) 362, 1024, 4232
PflMI CCANNNNNTGG 2 cut(s) 484, 1511
PfoI TCCNGGA 2 cut(s) 3576, 4837
PpuMI RGGWCCY 2 cut(s) 72, 1149
PscI ACATGT 2 cut(s) 4920, 4996
PshAI GACNNNNGTC 1 cut(s) 4581
PshBI ATTAAT 1 cut(s) 2051
PsiI TTATAA 3 cut(s) 1220, 1481, 2897
Psp124BI GAGCTC 1 cut(s) 2361
Psp5II RGGWCCY 2 cut(s) 72, 1149
PspEI GGTNACC 2 cut(s) 2204, 4562
PspFI CCCAGC 1 cut(s) 5085
PspPI GGNCC 8 cut(s) 72, 160, 397, 1149, 2089, 3198, 3884, 4352
PspPPI RGGWCCY 2 cut(s) 72, 1149
PstI CTGCAG 3 cut(s) 1038, 1083, 3992
PstNI CAGNNNCTG 2 cut(s) 4111, 4391
PsyI GACNNNGTC 3 cut(s) 362, 1024, 4232
PvuII CAGCTG 1 cut(s) 1238
RruI TCGCGA 1 cut(s) 2010
RseI CAYNNNNRTG 5 cut(s) 1407, 1842, 1937, 2199, 2920
SacI GAGCTC 1 cut(s) 2361
SapI GCTCTTC 1 cut(s) 4997
Sau96I GGNCC 8 cut(s) 72, 160, 397, 1149, 2089, 3198, 3884, 4352
ScaI AGTACT 1 cut(s) 1085
SduI GDGCHC 3 cut(s) 1821, 2361, 4371
SexAI ACCWGGT 1 cut(s) 1486
SfcI CTRYAG 8 cut(s) 1034, 1079, 1926, 2994, 3606, 3988, 4071, 4786
Sfr274I CTCGAG 2 cut(s) 2253, 3965
SinI GGWCC 4 cut(s) 72, 160, 397, 1149
SlaI CTCGAG 2 cut(s) 2253, 3965
SmiMI CAYNNNNRTG 5 cut(s) 1407, 1842, 1937, 2199, 2920
SmlI CTYRAG 8 cut(s) 800, 1153, 1998, 2253, 2596, 3965, 4286, 5134
SmoI CTYRAG 8 cut(s) 800, 1153, 1998, 2253, 2596, 3965, 4286, 5134
SpeI ACTAGT 1 cut(s) 3563
SspI AATATT 2 cut(s) 2612, 3457
SspMI CTAG 5 cut(s) 2037, 2568, 3471, 3564, 3914
SstI GAGCTC 1 cut(s) 2361
StyI CCWWGG 3 cut(s) 2036, 3370, 3830
TaiI ACGT 3 cut(s) 3488, 4045, 4889
TaqII GACCGA 1 cut(s) 516
TatI WGTACW 6 cut(s) 860, 1083, 1157, 2229, 4198, 4935
TauI GCSGC 6 cut(s) 37, 89, 124, 316, 2105, 4835
TfiI GAWTC 9 cut(s) 887, 894, 1637, 1861, 1945, 3254, 3727, 4253, 4961
TseFI GTSAC 4 cut(s) 2204, 2623, 3392, 4583
Tsp45I GTSAC 4 cut(s) 2204, 2623, 3392, 4583
TspGWI ACGGA 6 cut(s) 352, 1356, 1766, 1817, 3774, 4449
Tth111I GACNNNGTC 3 cut(s) 362, 1024, 4232
Van91I CCANNNNNTGG 2 cut(s) 484, 1511
VpaK11BI GGWCC 4 cut(s) 72, 160, 397, 1149
VspI ATTAAT 1 cut(s) 2051
XceI RCATGY 6 cut(s) 2402, 2522, 3633, 4875, 4924, 5000
XhoI CTCGAG 2 cut(s) 2253, 3965
XmaJI CCTAGG 1 cut(s) 2036
XmiI GTMKAC 1 cut(s) 2651
XmnI GAANNNNTTC 1 cut(s) 3731
XspI CTAG 5 cut(s) 2037, 2568, 3471, 3564, 3914
ZrmI AGTACT 1 cut(s) 1085
Zsp2I ATGCAT 1 cut(s) 2917
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.