Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012388.1

Orthogroup ID

OG0007541

Physical Location & Seq

Genomic Coordinates Forward (+)

8972 .. 10272

Gene Structure 1301 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012388.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 816 bp

atgtttcgcaacagcgaacagactcaacattcgcgaacaaacttagttattcagcgaacactacttctcagcgaacttactcacgacttacttttccctacagtgacattatctagcgaacttggaacgagtccagaagagaactacagaccgcatgcagctgtgcagtttcttggaagtcttggctacgatccaaactacggtgctaggccaatgaagcgagtgattcagcaatatgtagaaaataagcttgccaagggcatcttgaggggagagttcaaagaagaagacaccattttggtcgacacagaggtcacaacgtttgccaatggccaactaccccagcaaaagctagtcttcaagacgcattctgacgtgttcaatgttttccttcaaattttagatgatgggagagtaactgactcacagggccgcacttacatacttaacggagatgatgaagtatcgccaaaggagttgggttacgaaactataaagcagcgggtcatggagcctgcaaggtccatatttcgccctgagttcatgaatcgggttgatgagtacatagtttttcatcccttggaccgtgatcagataaacaacattgtcaagatacagttgcaacgagtccaaaagagaattgcagaccgcaagatgaagatccgacaatatgttgaaaatgagcttgccaagggcatcttgaggggagtgttcaaagaagaagacaccattttggtcgacacagaggtcacggcgtttgccaatggccagctaccccaacaaaagctagtcttcaagatgcttgaaactggttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006950 GO:0006996 GO:0008150 GO:0009266 GO:0009408 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009628 GO:0009657 GO:0009658 GO:0009987 GO:0016043 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0050896 GO:0071840

KEGG Pathways

Metabolic & Signaling

ko04213 map04213

Pfam Domains

Protein Families

AAA AAA_2 ClpB_D2-small Clp_N

Protein Analysis

271

Amino Acids

31.28

Weight (kDa)

6.03

Isoelectric Point (pI)

36.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007541)

Species	Orthologous Gene IDs
pyrus_communis	pycom15g03570
rosa_chinensis	RchiOBHm_Chr1g0330711
rosa_multiflora	Rmu_sc0002725.1_g000018 Rmu_sc0004826.1_g000001 Rmu_sc0012388.1_g000004 Rmu_sc0032321.1_g000001
rosa_roxburghii	Rroxscaffold_2G00084840 Rroxscaffold_2G00084850
rosa_rugosa	Rorug02G0523300
rosa_samantha	Rh1AG108100 Rh1AG109100 Rh1AG109300 Rh1AG110400 Rh1AG111300 Rh1CG104100 Rh1CG105000 Rh1CG105200 Rh1CG106700 Rh1DG114200 Rh1DG114800 Rh1DG115700 Rh2BG601800 Rh2CG572500 Rh2DG612200
rosa_wichuraiana	Rw4G012620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	311, 746
AccI	GTMKAC	2 cut(s)	303, 738
AccII	CGCG	1 cut(s)	34
AciI	CCGC	4 cut(s)	152, 433, 502, 649
AclI	AACGTT	1 cut(s)	320
AclWI	GGATC	2 cut(s)	185, 655
AcoI	YGGCCR	2 cut(s)	331, 766
AcsI	RAATTY	1 cut(s)	396
AfaI	GTAC	1 cut(s)	563
AfiI	CCNNNNNNNGG	1 cut(s)	200
AflIII	ACRYGT	1 cut(s)	375
AgsI	TTSAA	8 cut(s)	280, 361, 382, 395, 677, 715, 796, 806
AjiI	CACGTC	1 cut(s)	376
AluBI	AGCT	6 cut(s)	161, 250, 352, 685, 772, 787
AluI	AGCT	6 cut(s)	161, 250, 352, 685, 772, 787
AlwI	GGATC	2 cut(s)	185, 655
AoxI	GGCC	4 cut(s)	209, 331, 430, 766
ApeKI	GCWGC	2 cut(s)	158, 499
ApoI	RAATTY	1 cut(s)	396
ArsI	GACNNNNNNTTYG	2 cut(s)	13, 45
AspS9I	GGNCC	3 cut(s)	430, 522, 583
AvaII	GGWCC	2 cut(s)	522, 583
BalI	TGGCCA	2 cut(s)	333, 768
BbsI	GAAGAC	4 cut(s)	294, 349, 729, 784
BbvI	GCAGC	2 cut(s)	170, 511
BccI	CCATC	1 cut(s)	401
BceAI	ACGGC	1 cut(s)	768
BclI	TGATCA	1 cut(s)	589
BfaI	CTAG	4 cut(s)	114, 207, 353, 788
BfmI	CTRYAG	2 cut(s)	99, 145
BisI	GCNGC	3 cut(s)	159, 433, 500
BlsI	GCNGC	3 cut(s)	160, 434, 501
Bme18I	GGWCC	2 cut(s)	522, 583
BmgBI	CACGTC	1 cut(s)	376
BmgT120I	GGNCC	3 cut(s)	430, 522, 583
BmiI	GGNNCC	1 cut(s)	513
BmsI	GCATC	3 cut(s)	270, 705, 789
BpiI	GAAGAC	4 cut(s)	294, 349, 729, 784
BpuEI	CTTGAG	2 cut(s)	286, 721
BsaBI	GATNNNNATC	1 cut(s)	659
BsaJI	CCNNGG	3 cut(s)	255, 579, 690
Bsc4I	CCNNNNNNNGG	1 cut(s)	200
Bse1I	ACTGG	1 cut(s)	814
Bse8I	GATNNNNATC	1 cut(s)	659
BseDI	CCNNGG	3 cut(s)	255, 579, 690
BseGI	GGATG	1 cut(s)	574
BseJI	GATNNNNATC	1 cut(s)	659
BseLI	CCNNNNNNNGG	1 cut(s)	200
BseMII	CTCAG	2 cut(s)	82, 528
BseNI	ACTGG	1 cut(s)	814
BseXI	GCAGC	2 cut(s)	170, 511
BseYI	CCCAGC	1 cut(s)	342
BsgI	GTGCAG	1 cut(s)	185
Bsh1236I	CGCG	1 cut(s)	34
BshFI	GGCC	4 cut(s)	211, 333, 432, 768
BslI	CCNNNNNNNGG	1 cut(s)	200
BsmI	GAATGC	1 cut(s)	367
BsnI	GGCC	4 cut(s)	211, 333, 432, 768
Bsp143I	GATC	3 cut(s)	190, 589, 660
Bsp68I	TCGCGA	1 cut(s)	34
BspACI	CCGC	4 cut(s)	152, 433, 502, 649
BspANI	GGCC	4 cut(s)	211, 333, 432, 768
BspCNI	CTCAG	2 cut(s)	81, 529
BspFNI	CGCG	1 cut(s)	34
BspHI	TCATGA	1 cut(s)	543
BspLI	GGNNCC	1 cut(s)	513
BspPI	GGATC	2 cut(s)	185, 655
BsrI	ACTGG	1 cut(s)	814
BssECI	CCNNGG	3 cut(s)	255, 579, 690
BssMI	GATC	3 cut(s)	190, 589, 660
BssT1I	CCWWGG	3 cut(s)	255, 579, 690
Bst4CI	ACNGT	4 cut(s)	103, 203, 587, 618
Bst6I	CTCTTC	1 cut(s)	132
BstC8I	GCNNGC	5 cut(s)	156, 252, 516, 687, 770
BstDEI	CTNAG	3 cut(s)	43, 68, 537
BstF5I	GGATG	1 cut(s)	574
BstFNI	CGCG	1 cut(s)	34
BstKTI	GATC	3 cut(s)	193, 592, 663
BstMBI	GATC	3 cut(s)	190, 589, 660
BstMWI	GCNNNNNNNGC	1 cut(s)	217
BstNSI	RCATGY	1 cut(s)	158
BstSFI	CTRYAG	2 cut(s)	99, 145
BstUI	CGCG	1 cut(s)	34
BstV1I	GCAGC	2 cut(s)	170, 511
BstV2I	GAAGAC	4 cut(s)	294, 349, 729, 784
BstX2I	RGATCY	1 cut(s)	660
BstYI	RGATCY	1 cut(s)	660
BsuRI	GGCC	4 cut(s)	211, 333, 432, 768
BtrI	CACGTC	1 cut(s)	376
BtsCI	GGATG	1 cut(s)	574
BtsIMutI	CAGTG	1 cut(s)	108
BtuMI	TCGCGA	1 cut(s)	34
Cac8I	GCNNGC	5 cut(s)	156, 252, 516, 687, 770
CciI	TCATGA	1 cut(s)	543
Cfr13I	GGNCC	3 cut(s)	430, 522, 583
CseI	GACGC	1 cut(s)	373
Csp6I	GTAC	1 cut(s)	562
CviAII	CATG	3 cut(s)	155, 508, 544
CviQI	GTAC	1 cut(s)	562
DdeI	CTNAG	3 cut(s)	43, 68, 537
DpnI	GATC	3 cut(s)	192, 591, 662
DpnII	GATC	3 cut(s)	190, 589, 660
DrdI	GACNNNNNNGTC	2 cut(s)	311, 746
DseDI	GACNNNNNNGTC	2 cut(s)	311, 746
EaeI	YGGCCR	2 cut(s)	331, 766
Eam1104I	CTCTTC	1 cut(s)	132
EarI	CTCTTC	1 cut(s)	132
Eco130I	CCWWGG	3 cut(s)	255, 579, 690
Eco47I	GGWCC	2 cut(s)	522, 583
EcoT14I	CCWWGG	3 cut(s)	255, 579, 690
ErhI	CCWWGG	3 cut(s)	255, 579, 690
FaeI	CATG	3 cut(s)	158, 511, 547
FaiI	YATR	9 cut(s)	156, 237, 443, 494, 509, 527, 545, 566, 672
FalI	AAGNNNNNCTT	8 cut(s)	248, 280, 341, 373, 683, 715, 776, 808
FatI	CATG	3 cut(s)	154, 507, 543
FauI	CCCGC	1 cut(s)	495
FbaI	TGATCA	1 cut(s)	589
FblI	GTMKAC	2 cut(s)	303, 738
Fnu4HI	GCNGC	3 cut(s)	159, 433, 500
FokI	GGATG	1 cut(s)	561
Fsp4HI	GCNGC	3 cut(s)	159, 433, 500
FspBI	CTAG	4 cut(s)	114, 207, 353, 788
GluI	GCNGC	3 cut(s)	159, 433, 500
GsaI	CCCAGC	1 cut(s)	346
HaeIII	GGCC	4 cut(s)	211, 333, 432, 768
HgaI	GACGC	1 cut(s)	373
Hin1II	CATG	3 cut(s)	158, 511, 547
HincII	GTYRAC	2 cut(s)	304, 739
HindII	GTYRAC	2 cut(s)	304, 739
HindIII	AAGCTT	1 cut(s)	248
HinfI	GANTC	6 cut(s)	22, 130, 226, 422, 547, 627
Hpy166II	GTNNAC	2 cut(s)	304, 739
Hpy188I	TCNGA	3 cut(s)	373, 594, 665
Hpy188III	TCNNGA	9 cut(s)	33, 83, 134, 265, 361, 544, 610, 700, 796
Hpy8I	GTNNAC	2 cut(s)	304, 739
HpyAV	CCTTC	1 cut(s)	401
HpyCH4III	ACNGT	4 cut(s)	103, 203, 587, 618
HpyCH4IV	ACGT	2 cut(s)	320, 375
HpyCH4V	TGCA	5 cut(s)	158, 166, 518, 622, 644
HpyF10VI	GCNNNNNNNGC	1 cut(s)	217
HpyF3I	CTNAG	3 cut(s)	43, 68, 537
HpySE526I	ACGT	2 cut(s)	320, 375
Hsp92II	CATG	3 cut(s)	158, 511, 547
Ksp22I	TGATCA	1 cut(s)	589
Kzo9I	GATC	3 cut(s)	190, 589, 660
LmnI	GCTCC	1 cut(s)	511
LpnPI	CCDG	7 cut(s)	147, 356, 413, 528, 549, 782, 795
Lsp1109I	GCAGC	2 cut(s)	170, 511
LweI	GCATC	3 cut(s)	270, 705, 789
MaeI	CTAG	4 cut(s)	114, 207, 353, 788
MaeII	ACGT	2 cut(s)	320, 375
MaeIII	GTNAC	5 cut(s)	103, 313, 415, 482, 748
MalI	GATC	3 cut(s)	192, 591, 662
MboI	GATC	3 cut(s)	190, 589, 660
MboII	GAAGA	8 cut(s)	149, 296, 299, 349, 670, 731, 734, 784
MflI	RGATCY	1 cut(s)	660
MlsI	TGGCCA	2 cut(s)	333, 768
MluCI	AATT	2 cut(s)	396, 639
MluNI	TGGCCA	2 cut(s)	333, 768
MlyI	GAGTC	4 cut(s)	16, 139, 416, 636
MmeI	TCCRAC	1 cut(s)	688
MnlI	CCTC	4 cut(s)	261, 304, 696, 739
Mox20I	TGGCCA	2 cut(s)	333, 768
MscI	TGGCCA	2 cut(s)	333, 768
MseI	TTAA	2 cut(s)	447, 814
Msp20I	TGGCCA	2 cut(s)	333, 768
MspA1I	CMGCKG	2 cut(s)	161, 502
Mva1269I	GAATGC	1 cut(s)	367
MvnI	CGCG	1 cut(s)	34
MwoI	GCNNNNNNNGC	1 cut(s)	217
NdeII	GATC	3 cut(s)	190, 589, 660
NlaIII	CATG	3 cut(s)	158, 511, 547
NlaIV	GGNNCC	1 cut(s)	513
NmuCI	GTSAC	3 cut(s)	103, 313, 748
NruI	TCGCGA	1 cut(s)	34
NspI	RCATGY	1 cut(s)	158
PaeI	GCATGC	1 cut(s)	158
PagI	TCATGA	1 cut(s)	543
PctI	GAATGC	1 cut(s)	367
PfeI	GAWTC	2 cut(s)	226, 547
PkrI	GCNGC	3 cut(s)	160, 434, 501
PleI	GAGTC	4 cut(s)	16, 138, 416, 635
PpsI	GAGTC	4 cut(s)	16, 138, 416, 635
Psp1406I	AACGTT	1 cut(s)	320
PspFI	CCCAGC	1 cut(s)	342
PspN4I	GGNNCC	1 cut(s)	513
PspPI	GGNCC	3 cut(s)	430, 522, 583
PsuI	RGATCY	1 cut(s)	660
PvuII	CAGCTG	1 cut(s)	161
RruI	TCGCGA	1 cut(s)	34
RsaI	GTAC	1 cut(s)	563
RsaNI	GTAC	1 cut(s)	562
SalI	GTCGAC	2 cut(s)	302, 737
SaqAI	TTAA	2 cut(s)	447, 814
SatI	GCNGC	3 cut(s)	159, 433, 500
Sau3AI	GATC	3 cut(s)	190, 589, 660
Sau96I	GGNCC	3 cut(s)	430, 522, 583
SchI	GAGTC	4 cut(s)	16, 139, 416, 636
SfaNI	GCATC	3 cut(s)	270, 705, 789
SfcI	CTRYAG	2 cut(s)	99, 145
SinI	GGWCC	2 cut(s)	522, 583
SmlI	CTYRAG	2 cut(s)	265, 700
SmoI	CTYRAG	2 cut(s)	265, 700
SphI	GCATGC	1 cut(s)	158
Sse9I	AATT	2 cut(s)	396, 639
SsiI	CCGC	4 cut(s)	152, 433, 502, 649
SspMI	CTAG	4 cut(s)	114, 207, 353, 788
StyI	CCWWGG	3 cut(s)	255, 579, 690
TaaI	ACNGT	4 cut(s)	103, 203, 587, 618
TaiI	ACGT	2 cut(s)	323, 378
TaqI	TCGA	2 cut(s)	303, 738
TasI	AATT	2 cut(s)	396, 639
TatI	WGTACW	1 cut(s)	561
TauI	GCSGC	1 cut(s)	435
TfiI	GAWTC	2 cut(s)	226, 547
Tru1I	TTAA	2 cut(s)	447, 814
Tru9I	TTAA	2 cut(s)	447, 814
TscAI	CASTG	1 cut(s)	108
TseFI	GTSAC	3 cut(s)	103, 313, 748
TseI	GCWGC	2 cut(s)	158, 499
Tsp45I	GTSAC	3 cut(s)	103, 313, 748
TspDTI	ATGAA	6 cut(s)	230, 474, 532, 560, 563, 671
TspGWI	ACGGA	1 cut(s)	465
TspRI	CASTG	1 cut(s)	108
VpaK11BI	GGWCC	2 cut(s)	522, 583
XapI	RAATTY	1 cut(s)	396
XceI	RCATGY	1 cut(s)	158
XmiI	GTMKAC	2 cut(s)	303, 738
XspI	CTAG	4 cut(s)	114, 207, 353, 788

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.