Rroxscaffold_2G00084850

Belongs to the ClpA ClpB family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0007541
Physical Location & Seq
Forward (+)
7311620 .. 7311883
264 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00084850.1

Sequence Viewer

Length: 264 bp
ATGAAGATCCAAGTGAGCGAGGCAGCTGTGCAGCTTCTTGGAAATCTCAGCTACGATCCAAACTACGGTGCTAGGCTAATCAAGAGAGTGATTCAGCAATATGTAGAAAATGAGCTTGCCCTGGGCATCTTGAGAGGAGAGTTCAAAGAAGAAGACACCATTTTGGTCGACACGGAGGTCACGACGTTTGCCAATGGCCAGCTACCCCAGCAAAAGCTATTCTTCAAGTCGCTTGAAACTAGTTCAGAATCTCCTGCAGCATAG

Protein Analysis

87

Amino Acids

9.7

Weight (kDa)

4.67

Isoelectric Point (pI)

35.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ClpB_D2-small PF10431 1 - 56 7.5e-16 C-terminal, D2-small domain, of ClpB protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 176
AccI GTMKAC 1 cut(s) 168
AclWI GGATC 1 cut(s) 50
AcoI YGGCCR 1 cut(s) 196
AfiI CCNNNNNNNGG 1 cut(s) 65
AgsI TTSAA 3 cut(s) 145, 226, 236
AhlI ACTAGT 1 cut(s) 239
AjnI CCWGG 1 cut(s) 120
AluBI AGCT 6 cut(s) 26, 34, 51, 115, 202, 217
AluI AGCT 6 cut(s) 26, 34, 51, 115, 202, 217
AlwI GGATC 1 cut(s) 50
AoxI GGCC 1 cut(s) 196
ApeKI GCWGC 3 cut(s) 23, 31, 257
BalI TGGCCA 1 cut(s) 198
BbsI GAAGAC 1 cut(s) 159
BbvI GCAGC 2 cut(s) 35, 43
BciT130I CCWGG 1 cut(s) 122
BcuI ACTAGT 1 cut(s) 239
BfaI CTAG 2 cut(s) 72, 240
BfmI CTRYAG 1 cut(s) 255
BisI GCNGC 3 cut(s) 24, 32, 258
BlsI GCNGC 3 cut(s) 25, 33, 259
Bme1390I CCNGG 1 cut(s) 122
BmrFI CCNGG 1 cut(s) 122
BmsI GCATC 1 cut(s) 135
BpiI GAAGAC 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 151
BsaJI CCNNGG 2 cut(s) 120, 121
Bsc4I CCNNNNNNNGG 1 cut(s) 65
BseBI CCWGG 1 cut(s) 122
BseDI CCNNGG 2 cut(s) 120, 121
BseLI CCNNNNNNNGG 1 cut(s) 65
BseMII CTCAG 1 cut(s) 61
BseRI GAGGAG 1 cut(s) 150
BseXI GCAGC 2 cut(s) 35, 43
BseYI CCCAGC 1 cut(s) 207
BsgI GTGCAG 1 cut(s) 50
BshFI GGCC 1 cut(s) 198
BslI CCNNNNNNNGG 1 cut(s) 65
BsnI GGCC 1 cut(s) 198
Bsp143I GATC 2 cut(s) 6, 55
BspANI GGCC 1 cut(s) 198
BspCNI CTCAG 1 cut(s) 60
BspMAI CTGCAG 1 cut(s) 259
BspPI GGATC 1 cut(s) 50
BssECI CCNNGG 2 cut(s) 120, 121
BssMI GATC 2 cut(s) 6, 55
Bst2UI CCWGG 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 68
BstC8I GCNNGC 2 cut(s) 117, 200
BstDEI CTNAG 1 cut(s) 47
BstKTI GATC 2 cut(s) 9, 58
BstMBI GATC 2 cut(s) 6, 55
BstMWI GCNNNNNNNGC 1 cut(s) 208
BstNI CCWGG 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 120
BstSFI CTRYAG 1 cut(s) 255
BstV1I GCAGC 2 cut(s) 35, 43
BstV2I GAAGAC 1 cut(s) 159
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
BsuRI GGCC 1 cut(s) 198
Cac8I GCNNGC 2 cut(s) 117, 200
CviJI RGCY 8 cut(s) 26, 34, 51, 76, 115, 198, 202, 217
CviKI_1 RGCY 8 cut(s) 26, 34, 51, 76, 115, 198, 202, 217
DdeI CTNAG 1 cut(s) 47
DpnI GATC 2 cut(s) 8, 57
DpnII GATC 2 cut(s) 6, 55
DrdI GACNNNNNNGTC 1 cut(s) 176
DseDI GACNNNNNNGTC 1 cut(s) 176
EaeI YGGCCR 1 cut(s) 196
EcoRII CCWGG 1 cut(s) 120
FaiI YATR 2 cut(s) 102, 262
FalI AAGNNNNNCTT 2 cut(s) 206, 238
FblI GTMKAC 1 cut(s) 168
Fnu4HI GCNGC 3 cut(s) 24, 32, 258
Fsp4HI GCNGC 3 cut(s) 24, 32, 258
FspBI CTAG 2 cut(s) 72, 240
GluI GCNGC 3 cut(s) 24, 32, 258
GsaI CCCAGC 1 cut(s) 211
HaeIII GGCC 1 cut(s) 198
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
HinfI GANTC 2 cut(s) 91, 248
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 247
Hpy188III TCNNGA 3 cut(s) 82, 130, 181
Hpy8I GTNNAC 1 cut(s) 169
Hpy99I CGWCG 1 cut(s) 187
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4IV ACGT 1 cut(s) 185
HpyCH4V TGCA 2 cut(s) 31, 257
HpyF10VI GCNNNNNNNGC 1 cut(s) 208
HpyF3I CTNAG 1 cut(s) 47
HpySE526I ACGT 1 cut(s) 185
Kzo9I GATC 2 cut(s) 6, 55
LpnPI CCDG 4 cut(s) 107, 134, 212, 221
Lsp1109I GCAGC 2 cut(s) 35, 43
LweI GCATC 1 cut(s) 135
MaeI CTAG 2 cut(s) 72, 240
MaeII ACGT 1 cut(s) 185
MaeIII GTNAC 1 cut(s) 178
MalI GATC 2 cut(s) 8, 57
MboI GATC 2 cut(s) 6, 55
MboII GAAGA 4 cut(s) 16, 161, 164, 214
MflI RGATCY 1 cut(s) 6
MlsI TGGCCA 1 cut(s) 198
MluNI TGGCCA 1 cut(s) 198
MnlI CCTC 3 cut(s) 13, 128, 169
Mox20I TGGCCA 1 cut(s) 198
MscI TGGCCA 1 cut(s) 198
Msp20I TGGCCA 1 cut(s) 198
MspA1I CMGCKG 1 cut(s) 26
MspR9I CCNGG 1 cut(s) 122
MvaI CCWGG 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 208
NdeII GATC 2 cut(s) 6, 55
NmuCI GTSAC 1 cut(s) 178
PasI CCCWGGG 1 cut(s) 121
PcsI WCGNNNNNNNCGW 1 cut(s) 179
PfeI GAWTC 2 cut(s) 91, 248
PkrI GCNGC 3 cut(s) 25, 33, 259
Psp6I CCWGG 1 cut(s) 120
PspFI CCCAGC 1 cut(s) 207
PspGI CCWGG 1 cut(s) 120
PstI CTGCAG 1 cut(s) 259
PsuI RGATCY 1 cut(s) 6
PvuII CAGCTG 1 cut(s) 26
SalI GTCGAC 1 cut(s) 167
SatI GCNGC 3 cut(s) 24, 32, 258
Sau3AI GATC 2 cut(s) 6, 55
ScrFI CCNGG 1 cut(s) 122
SetI ASST 8 cut(s) 28, 36, 53, 117, 180, 188, 204, 219
SfaNI GCATC 1 cut(s) 135
SfcI CTRYAG 1 cut(s) 255
SmlI CTYRAG 1 cut(s) 130
SmoI CTYRAG 1 cut(s) 130
SpeI ACTAGT 1 cut(s) 239
SspMI CTAG 2 cut(s) 72, 240
StyD4I CCNGG 1 cut(s) 120
TaaI ACNGT 1 cut(s) 68
TaiI ACGT 1 cut(s) 188
TaqI TCGA 1 cut(s) 168
TfiI GAWTC 2 cut(s) 91, 248
TseFI GTSAC 1 cut(s) 178
TseI GCWGC 3 cut(s) 23, 31, 257
Tsp45I GTSAC 1 cut(s) 178
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 188
XmiI GTMKAC 1 cut(s) 168
XspI CTAG 2 cut(s) 72, 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.