Rmu_sc0032321.1_g000001

Belongs to the ClpA ClpB family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032321.1
Physical Location & Seq
Reverse (-)
1077 .. 2000
924 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032321.1_g000001.1.cds

Sequence Viewer

Length: 639 bp
atgaaaatccaagtgagtgatgcagctgtgcagcttcttggaagtcttggctacgattcaaactacggtgctaggtcagtgaagctagtgattcagcaatatgtagaaaataagcttgccaagggcatcttgaggggagagttcaaagaagaagacaccattttggtcgacacagagggcggccctgtgagtttcaccaacaccgtgatcattatgacctcaaatgttggttcacagtacatacttaacggagatgatgaagtatcgccaaaggagttgggtcatgaaactataaagcagcgggtcatggaggctgcaaggtccatatttcgccctgagttcatgaatcgggttgatgagtacatagttttccatcccttagaccgtgatcagataaacaacattgtcaagatacagctgtgcagcttcttggaaatctcggctacaatccaaactacgggagctaggccaatcaagcgagtgattcagcaatatgtggaaaatgagcttgccaagggcattttgaggggagagttcaaagaagaagacaccactttggtcgacacagaggtcacagcgtttgccaatggccagctaccccagcaaaagctagtcttcaagatgcttgaaactggttaa

Protein Analysis

212

Amino Acids

23.79

Weight (kDa)

5.01

Isoelectric Point (pI)

26.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 569
AccI GTMKAC 2 cut(s) 168, 561
AciI CCGC 2 cut(s) 180, 301
AcoI YGGCCR 1 cut(s) 589
AfaI GTAC 2 cut(s) 239, 362
AfiI CCNNNNNNNGG 1 cut(s) 457
AgsI TTSAA 5 cut(s) 60, 145, 538, 619, 629
AoxI GGCC 3 cut(s) 181, 467, 589
ApeKI GCWGC 5 cut(s) 23, 31, 298, 314, 423
AspS9I GGNCC 2 cut(s) 182, 321
AsuHPI GGTGA 1 cut(s) 187
AvaII GGWCC 1 cut(s) 321
BaeI ACNNNNGTAYC 2 cut(s) 404, 437
BalI TGGCCA 1 cut(s) 591
BbsI GAAGAC 3 cut(s) 159, 552, 607
BbvI GCAGC 5 cut(s) 35, 43, 301, 310, 435
BccI CCATC 1 cut(s) 381
BclI TGATCA 2 cut(s) 207, 388
BfaI CTAG 4 cut(s) 72, 86, 465, 611
BisI GCNGC 6 cut(s) 24, 32, 181, 299, 315, 424
BlsI GCNGC 6 cut(s) 25, 33, 182, 300, 316, 425
Bme18I GGWCC 1 cut(s) 321
BmgT120I GGNCC 2 cut(s) 182, 321
BmsI GCATC 3 cut(s) 10, 135, 612
BpiI GAAGAC 3 cut(s) 159, 552, 607
BpuEI CTTGAG 1 cut(s) 151
BsaJI CCNNGG 2 cut(s) 120, 513
Bsc4I CCNNNNNNNGG 1 cut(s) 457
Bse1I ACTGG 1 cut(s) 637
BseDI CCNNGG 2 cut(s) 120, 513
BseGI GGATG 1 cut(s) 373
BseLI CCNNNNNNNGG 1 cut(s) 457
BseMII CTCAG 1 cut(s) 327
BseNI ACTGG 1 cut(s) 637
BseXI GCAGC 5 cut(s) 35, 43, 301, 310, 435
BseYI CCCAGC 1 cut(s) 600
BsgI GTGCAG 2 cut(s) 50, 442
BshFI GGCC 3 cut(s) 183, 469, 591
BslI CCNNNNNNNGG 1 cut(s) 457
BsnI GGCC 3 cut(s) 183, 469, 591
Bsp143I GATC 2 cut(s) 207, 388
BspACI CCGC 2 cut(s) 180, 301
BspANI GGCC 3 cut(s) 183, 469, 591
BspCNI CTCAG 1 cut(s) 328
BspHI TCATGA 2 cut(s) 283, 342
BsrI ACTGG 1 cut(s) 637
BssECI CCNNGG 2 cut(s) 120, 513
BssMI GATC 2 cut(s) 207, 388
BssT1I CCWWGG 2 cut(s) 120, 513
Bst4CI ACNGT 4 cut(s) 68, 205, 237, 386
BstC8I GCNNGC 3 cut(s) 117, 510, 593
BstDEI CTNAG 2 cut(s) 336, 379
BstF5I GGATG 1 cut(s) 373
BstKTI GATC 2 cut(s) 210, 391
BstMBI GATC 2 cut(s) 207, 388
BstMWI GCNNNNNNNGC 2 cut(s) 475, 601
BstV1I GCAGC 5 cut(s) 35, 43, 301, 310, 435
BstV2I GAAGAC 3 cut(s) 159, 552, 607
BsuRI GGCC 3 cut(s) 183, 469, 591
BtsCI GGATG 1 cut(s) 373
BtsIMutI CAGTG 1 cut(s) 84
Cac8I GCNNGC 3 cut(s) 117, 510, 593
CciI TCATGA 2 cut(s) 283, 342
Cfr13I GGNCC 2 cut(s) 182, 321
Csp6I GTAC 2 cut(s) 238, 361
CviAII CATG 3 cut(s) 284, 307, 343
CviQI GTAC 2 cut(s) 238, 361
DdeI CTNAG 2 cut(s) 336, 379
DpnI GATC 2 cut(s) 209, 390
DpnII GATC 2 cut(s) 207, 388
DrdI GACNNNNNNGTC 1 cut(s) 569
DseDI GACNNNNNNGTC 1 cut(s) 569
EaeI YGGCCR 1 cut(s) 589
Eco130I CCWWGG 2 cut(s) 120, 513
Eco47I GGWCC 1 cut(s) 321
EcoT14I CCWWGG 2 cut(s) 120, 513
ErhI CCWWGG 2 cut(s) 120, 513
FaeI CATG 3 cut(s) 287, 310, 346
FalI AAGNNNNNCTT 4 cut(s) 113, 145, 599, 631
FatI CATG 3 cut(s) 283, 306, 342
FauI CCCGC 1 cut(s) 294
FbaI TGATCA 2 cut(s) 207, 388
FblI GTMKAC 2 cut(s) 168, 561
Fnu4HI GCNGC 6 cut(s) 24, 32, 181, 299, 315, 424
FokI GGATG 1 cut(s) 360
Fsp4HI GCNGC 6 cut(s) 24, 32, 181, 299, 315, 424
FspBI CTAG 4 cut(s) 72, 86, 465, 611
GluI GCNGC 6 cut(s) 24, 32, 181, 299, 315, 424
GsaI CCCAGC 1 cut(s) 604
HaeIII GGCC 3 cut(s) 183, 469, 591
Hin1II CATG 3 cut(s) 287, 310, 346
HincII GTYRAC 2 cut(s) 169, 562
HindII GTYRAC 2 cut(s) 169, 562
HindIII AAGCTT 1 cut(s) 113
HinfI GANTC 4 cut(s) 56, 91, 346, 484
HphI GGTGA 1 cut(s) 187
Hpy166II GTNNAC 3 cut(s) 169, 233, 562
Hpy188I TCNGA 1 cut(s) 393
Hpy188III TCNNGA 5 cut(s) 130, 284, 343, 409, 619
Hpy8I GTNNAC 3 cut(s) 169, 233, 562
HpyCH4III ACNGT 4 cut(s) 68, 205, 237, 386
HpyCH4V TGCA 4 cut(s) 23, 31, 317, 423
HpyF10VI GCNNNNNNNGC 2 cut(s) 475, 601
HpyF3I CTNAG 2 cut(s) 336, 379
Hsp92II CATG 3 cut(s) 287, 310, 346
Ksp22I TGATCA 2 cut(s) 207, 388
Kzo9I GATC 2 cut(s) 207, 388
LmnI GCTCC 1 cut(s) 461
LpnPI CCDG 5 cut(s) 198, 348, 605, 614, 618
Lsp1109I GCAGC 5 cut(s) 35, 43, 301, 310, 435
LweI GCATC 3 cut(s) 10, 135, 612
MaeI CTAG 4 cut(s) 72, 86, 465, 611
MaeIII GTNAC 1 cut(s) 571
MalI GATC 2 cut(s) 209, 390
MboI GATC 2 cut(s) 207, 388
MboII GAAGA 5 cut(s) 161, 164, 554, 557, 607
MlsI TGGCCA 1 cut(s) 591
MluNI TGGCCA 1 cut(s) 591
MnlI CCTC 6 cut(s) 126, 169, 229, 304, 519, 562
Mox20I TGGCCA 1 cut(s) 591
MscI TGGCCA 1 cut(s) 591
MseI TTAA 2 cut(s) 246, 637
Msp20I TGGCCA 1 cut(s) 591
MspA1I CMGCKG 3 cut(s) 26, 301, 418
MwoI GCNNNNNNNGC 2 cut(s) 475, 601
NdeII GATC 2 cut(s) 207, 388
NlaIII CATG 3 cut(s) 287, 310, 346
NmeAIII GCCGAG 1 cut(s) 419
NmuCI GTSAC 1 cut(s) 571
PagI TCATGA 2 cut(s) 283, 342
PfeI GAWTC 4 cut(s) 56, 91, 346, 484
PkrI GCNGC 6 cut(s) 25, 33, 182, 300, 316, 425
PspFI CCCAGC 1 cut(s) 600
PspPI GGNCC 2 cut(s) 182, 321
PvuII CAGCTG 2 cut(s) 26, 418
RsaI GTAC 2 cut(s) 239, 362
RsaNI GTAC 2 cut(s) 238, 361
SalI GTCGAC 2 cut(s) 167, 560
SaqAI TTAA 2 cut(s) 246, 637
SatI GCNGC 6 cut(s) 24, 32, 181, 299, 315, 424
Sau3AI GATC 2 cut(s) 207, 388
Sau96I GGNCC 2 cut(s) 182, 321
SfaNI GCATC 3 cut(s) 10, 135, 612
SinI GGWCC 1 cut(s) 321
SmlI CTYRAG 1 cut(s) 130
SmoI CTYRAG 1 cut(s) 130
SsiI CCGC 2 cut(s) 180, 301
SspMI CTAG 4 cut(s) 72, 86, 465, 611
StyI CCWWGG 2 cut(s) 120, 513
TaaI ACNGT 4 cut(s) 68, 205, 237, 386
TaqI TCGA 2 cut(s) 168, 561
TatI WGTACW 2 cut(s) 237, 360
TauI GCSGC 1 cut(s) 183
TfiI GAWTC 4 cut(s) 56, 91, 346, 484
Tru1I TTAA 2 cut(s) 246, 637
Tru9I TTAA 2 cut(s) 246, 637
TscAI CASTG 1 cut(s) 84
TseFI GTSAC 1 cut(s) 571
TseI GCWGC 5 cut(s) 23, 31, 298, 314, 423
Tsp45I GTSAC 1 cut(s) 571
TspDTI ATGAA 5 cut(s) 17, 273, 300, 331, 359
TspGWI ACGGA 1 cut(s) 264
TspRI CASTG 1 cut(s) 84
VpaK11BI GGWCC 1 cut(s) 321
XmiI GTMKAC 2 cut(s) 168, 561
XspI CTAG 4 cut(s) 72, 86, 465, 611
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.