Rh1AG109300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
18907905 .. 18912189
4285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG109300.1

Sequence Viewer

Length: 267 bp
ATGTCCACAGATCGAGGCTTGGAAAGTGGCAGAGTGGGAAGCTCAGCTCGACTTTCCGCCGTCCTTCGCTCCAAAATCTTCGATATCCGCTTTGCAGAGCCCCAAAACCCAAGTAAATATCATGTCATAGACAAACCGAGCTCAGCCGGACTACGCCGGAGCTCAGCCCGATGGCTCAAAATGAGCAGTAGCATGCATATAGGAACGTCCCTCACGACAAGGTGGAGACATTATACTGCTGAACTTGTCTACAGATACTTAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.03

Weight (kDa)

10.92

Isoelectric Point (pI)

89.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 249
AciI CCGC 2 cut(s) 57, 88
AluBI AGCT 4 cut(s) 42, 47, 141, 162
AluI AGCT 4 cut(s) 42, 47, 141, 162
Alw21I GWGCWC 2 cut(s) 143, 164
Alw26I GTCTC 1 cut(s) 220
BanII GRGCYC 3 cut(s) 102, 143, 164
Bbv12I GWGCWC 2 cut(s) 143, 164
BccI CCATC 1 cut(s) 165
BceAI ACGGC 1 cut(s) 44
BcoDI GTCTC 1 cut(s) 220
BfmI CTRYAG 1 cut(s) 250
BlpI GCTNAGC 3 cut(s) 43, 142, 163
Bpu1102I GCTNAGC 3 cut(s) 43, 142, 163
BseMII CTCAG 3 cut(s) 57, 156, 177
BsiHKAI GWGCWC 2 cut(s) 143, 164
BsiSI CCGG 2 cut(s) 147, 157
BslFI GGGAC 1 cut(s) 193
BsmAI GTCTC 1 cut(s) 220
BsmFI GGGAC 1 cut(s) 193
Bsp1286I GDGCHC 3 cut(s) 102, 143, 164
Bsp143I GATC 1 cut(s) 10
Bsp1720I GCTNAGC 3 cut(s) 43, 142, 163
BspACI CCGC 2 cut(s) 57, 88
BspCNI CTCAG 3 cut(s) 56, 155, 176
BssMI GATC 1 cut(s) 10
BstC8I GCNNGC 1 cut(s) 194
BstDEI CTNAG 3 cut(s) 43, 142, 163
BstKTI GATC 1 cut(s) 13
BstMAI GTCTC 1 cut(s) 220
BstMBI GATC 1 cut(s) 10
BstNSI RCATGY 1 cut(s) 196
BstSFI CTRYAG 1 cut(s) 250
Cac8I GCNNGC 1 cut(s) 194
CviAII CATG 2 cut(s) 122, 193
CviJI RGCY 9 cut(s) 18, 42, 47, 100, 141, 146, 162, 167, 175
CviKI_1 RGCY 9 cut(s) 18, 42, 47, 100, 141, 146, 162, 167, 175
DdeI CTNAG 3 cut(s) 43, 142, 163
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
EciI GGCGGA 1 cut(s) 46
Ecl136II GAGCTC 2 cut(s) 141, 162
Eco24I GRGCYC 3 cut(s) 102, 143, 164
Eco32I GATATC 1 cut(s) 85
Eco53kI GAGCTC 2 cut(s) 141, 162
EcoICRI GAGCTC 2 cut(s) 141, 162
EcoRV GATATC 1 cut(s) 85
EcoT22I ATGCAT 1 cut(s) 198
EcoT38I GRGCYC 3 cut(s) 102, 143, 164
FaeI CATG 2 cut(s) 125, 196
FaiI YATR 6 cut(s) 123, 128, 194, 198, 200, 234
FaqI GGGAC 1 cut(s) 193
FatI CATG 2 cut(s) 121, 192
FblI GTMKAC 1 cut(s) 249
FriOI GRGCYC 3 cut(s) 102, 143, 164
HapII CCGG 2 cut(s) 147, 157
Hin1II CATG 2 cut(s) 125, 196
HpaII CCGG 2 cut(s) 147, 157
Hpy166II GTNNAC 2 cut(s) 6, 250
Hpy188III TCNNGA 1 cut(s) 214
Hpy8I GTNNAC 2 cut(s) 6, 250
HpyAV CCTTC 1 cut(s) 74
HpyCH4IV ACGT 1 cut(s) 206
HpyCH4V TGCA 2 cut(s) 95, 196
HpyF3I CTNAG 3 cut(s) 43, 142, 163
HpySE526I ACGT 1 cut(s) 206
Hsp92II CATG 2 cut(s) 125, 196
Kzo9I GATC 1 cut(s) 10
LmnI GCTCC 2 cut(s) 74, 159
LpnPI CCDG 2 cut(s) 160, 170
MaeII ACGT 1 cut(s) 206
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MboII GAAGA 1 cut(s) 70
MhlI GDGCHC 3 cut(s) 102, 143, 164
MluCI AATT 1 cut(s) 262
MnlI CCTC 2 cut(s) 8, 221
Mph1103I ATGCAT 1 cut(s) 198
MseI TTAA 2 cut(s) 260, 265
MspI CCGG 2 cut(s) 147, 157
NdeII GATC 1 cut(s) 10
NlaIII CATG 2 cut(s) 125, 196
NsiI ATGCAT 1 cut(s) 198
NspI RCATGY 1 cut(s) 196
PaeI GCATGC 1 cut(s) 196
PcsI WCGNNNNNNNCGW 1 cut(s) 212
Psp124BI GAGCTC 2 cut(s) 143, 164
SacI GAGCTC 2 cut(s) 143, 164
SaqAI TTAA 2 cut(s) 260, 265
Sau3AI GATC 1 cut(s) 10
SduI GDGCHC 3 cut(s) 102, 143, 164
SetI ASST 6 cut(s) 44, 49, 143, 164, 209, 224
SfcI CTRYAG 1 cut(s) 250
SphI GCATGC 1 cut(s) 196
Sse9I AATT 1 cut(s) 262
SsiI CCGC 2 cut(s) 57, 88
SstI GAGCTC 2 cut(s) 143, 164
TaiI ACGT 1 cut(s) 209
TaqI TCGA 3 cut(s) 13, 49, 81
TasI AATT 1 cut(s) 262
Tru1I TTAA 2 cut(s) 260, 265
Tru9I TTAA 2 cut(s) 260, 265
XceI RCATGY 1 cut(s) 196
XmiI GTMKAC 1 cut(s) 249
Zsp2I ATGCAT 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.