Rmu_sc0013188.1_g000005

ATP-dependent helicase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013188.1
Physical Location & Seq
Forward (+)
21592 .. 31819
10228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013188.1_g000005.1.cds

Sequence Viewer

Length: 6906 bp
atgcaatcgggtggaggaggaggaggtgggcccgggcggaacccgggagtggggccggcgggacgggcaacgtcgaattcgtcggctgcttcgccgtcgtcgtcgtcgtcggcggtgtcgacgccgcacttggggtttgattcggtgcagcagcaccagcagcatcagcaacagcagcagcagcagcagcagcaattggggtctagacaggtgagaaattttgtggctttttgtggaattggaatgtgggttgtggaattgggagtgagtctggaaatgggtcgtccttgtttcaagccattgcaacaacaatttttaagaaagcccgaagggaatgaagctcttctagcatatcaagctgctgctttccaaggagttttgagtgggaacaattttgtttcagctcccggctccactcaaatgcctcaacaacctaggaagttcatggatatggctcaacagcatggctcacaggaggggcagaataggagtcaaggtgttgaccagcaagtgctaaatccagtccatcaagcttatcttcagtatgcttttcaggcttcacagcagaagtctggtttggcaatgcaatctcagcagcaacctaaaatggggatgttggggcctccatcgggaaaggatcaagacatgcggtctgcaaatttgaaaatgcaggaattcaattctatgcaggcagctagccaggcacaagcatcatcatcaaaaaacttgtcatcaaagaactcaacagagcattttgctcgtggagaaaagcagatggaccgaggacagtcaccagcttcggaccaaaggagtgaatctaagccttcagcccagccagcagccgtaggacaatatatgcctggaaatctcatgaggccaatgatggctccacagcaaagcatgcaaaatatgccaaacaaccagatggcactggctgctcagttgcaagcatttgcacttgagcacaatattgatctttcacaacctggaaatgccaacttgatggcacagctgattccaatgttgcagtctaggatggctactcaacaaaaggcgaatgagagcaacatgggtgtacaatcgtcttctgctccagtttcaaagcagcaggttacttctcctcaagttgcaagtgagagttctcctcatgctaattcatcaagtgatgtatctgggcagtcaggctctgcaaaagcaaagcagacagtttcacctagcccttttggctcaggttcaagtagtgggatctttaacaatagtaacaacattcctatgcagcagttttctggtcacggcagagaaaaccagatacctcctaggcagtcagctccttttgtaaatggaatggctcctacccatcccacacacccatctacaaacacaagccaaggtctcgatcaatctctccatgtaaaaaatttacctaacaatccagaaacattgcaaatgcaataccctaggcagttaaatcgttcttctccacaagctgtcgttcctaatgatgggggctcgggcaatcacagtgttcagtcacaaggtggaccagctcctcaggtgccacaacaacgccctggattcaccaaacagcagctgcatgttctcaaagcacaaatactagcatttaggcgaatcaagaaaggtgaaggtacactccctcaggaacttcttcgggcgattgctccaccacctctagagcaacagctacagcagcaaattcttcctggaggaaatattcaggacaaatcttctgggaagattgtagaagaacatgctgtggagtccagtgaaaaggattctcattcacaggctgtggcatcagtgaatggaccgaacatttcaaaacaggaagctcttacaggagatgagaaggcaactgtatcaacaattaatgtgcatggaatgcctgctgtgctgaaggaacctactcctgtggtgtctgtgggaaaagaacaacattctgctgtagcttcagttaagtcagaccatgaagttgaacgtagtaaccaaaaagattctgtcagaagtgatttttctgtagacaggggaaagtctgttgcaccacaagttgctgtatctgatgccatgcaacttaaaaagcccgcacaagcaagctccacaccccagccaaaagatgcaggctctgccagaaagtatcatggaccactgtttgatttcccctttttcactaggaaacatgactcctttggttcagcaatgatggtgaacaacaacagcaacaacagtaatagtaataatttaacattggcatatgatgtcaaagaccttctttttgaggaaggtgtggaagttcttaacaagaagaggacagaaaatataaagaagattggtggtctcttggcggtaaacttagagaggaaaaggattaggccagatcttgttttgcggctgcaaattgaagagaaaaagctccgacttttggattttcaggcacgtttaagagatgaaattgatcaacagcagcaagaaataatggcaatgcctgacaggccttatcgcaagtttgttcgtctttgtgagcgtcagcgtatggagctagccaggcaagtgcaggcctctcagaaagctatgagagagaagcaactgaaatctattttcctgtggcgtaaaaggcttcttgaagctcactggtccattcgtgatgcacgaactgcacgcaacaggggagttgccaaatatcatgagagaatgttaagggagttttcaaaaagaaaggatgatgatagaagcagaaggatggaagcattgaagaataatgatgttgaaaggtacagggaaatgttgctagaacagcagactagtattacaggggatgcagcagagagatatgctgttctttcatcattcctgagccagacagaggaatatcttcataagcttgggagtaaaataacagctgctaaaaatcagcaggaagtggaagaggcagcaaatgctgctgcagctgctgcacgattgcagggtctgtccgaggaagaagttagggtggcagctgcttgtgctggagaggaagtattgattagaaatcggtttatagaaatgaatgcaccaagagatagttcatccgtcaacaagtattatagtcttgcacatgctgtaaatgaaagggtcataagacaaccatcaatgttacggactggaaccttaagagactatcaacttgttgggctccaatggatgctttctctgtataacaacaagttaaatggaatattggcagatgaaatgggtcttgggaaaactgtacaggtaatggcattgattgcatatttgatggagttcaaggggaactatggaccgcatctcataattgttccaaacgctgttttggtaaattggaagagtgagttgcatacttggcttccatctgtctcttgcatttattatgttgggagcaaggatcaacgatcaaaattgttttctcaagaggtttgcgccttgaagtttaatgtccttgtgacaacttatgagttcatcatgtatgatcgctccaaactatcaaaaattgattggaagtatataataattgatgaagcacagaggatgaaagacagggaatccgttctagcacgtgatcttgatagatatcgttgccaacggcgcttgcttttgacaggaacaccattgcagaatgatttgaaggaactctggtcacttttaaatctgcttcttccagaagtttttgataatcgcaaagcatttcatgactggttttctaaaccgtttcaaagggaggctcctacaccggatgcggacgatgattggcttgagactgagaaaaaggttatcattatccatcgactccatcaaatattagagccgtttatgctcaggcggcgggttgaagatgtcgaaggcgcacttccacctaagatctccatagttttaaggtgtagaatgtcggctattcaaagtgctgtatatgattggataaaatcaacaggcaccattcgtgttgatcccgaagacgagaagctaagggtccaaaaaaatccactttatcagcccaaggtgtataaaaccttaaataataggtgtatggaacttcgaaaaacttgcaatcatcctctgcttaattacccatacttcaatgatttttcaaaggattttctcataagatcctgtgggaaattgtggatcctggataggatcctaattaaacttcagagaacagggcatcgggtacttcttttcagtaccatgacaaaactccttgatatattggaggaatacttgcagtggaggcgacttgtgtacagacgaattgatggaaccaccagtttagaagatcgtgaatcagctatagtggatttcaacagccctgattcagactgcttcatcttcttgcttagtattcgtgcagctggtcggggtcttaatctccagtctgcggacacagttgtcatatatgatcctgatccaaaccctaaaaatgaagaacaggcagttgctagagcccaccgtattggacagaagagggaagtcaaagtcatttatatggaagcagttgttgacaaaatccctagccatcagaaagaggatgaactaagaactggaggcactgttgattcagaggatgaccttgctggtaaggaccgatatatgggatcaattgagagcctcataagaaataatattcagcaatacaagatagacatggctgatgaggttatcaatgctgggcgttttgaccagagaactactcatgaagagcgacgaatgactctggaaactttactgcatgatgatgagaggtatcaagaaactctccacgatgttccctcattgcaggaggtaaatcgcatgattgctagaagtgaagaagaagttgaattgtttgatcaaatggacgaagaatatgactggattgaggagatgacgaggtatgatcaggttcccaaatggcttcgtactagtacaagagaagtaaatactgtgattgctagtttatcgaaacgaccatcaaagaacactttgttgggtggaaatattggcttggagtcgagtgaagtgggttctgagactgaaagaaagaggggtcgacccaagggaaaaaagcatctcagctataaggaagtagatgatgaaactggagaatattcagaagcaagttctgatgagagaaatggatatcccatgcatgaagaggaaggagaagtaggagaattggaagatgatgaatatagtggtgctgttgaggcaactccagttgaagaaaaggaacaagtggaagatggtcctgaatgtgatggtgggtatgattatccaccagcttcagaaagagttggaaatgacctcatcgtagaagaagctggttcctcaggttcttcgtcagacagtcggagattgatgcagccactttctcctgtttcctctcagaagtttggttccctgtctgccttagatggtaggtcaggatctatttcaaagaggctgccagatgaagtagaggaaggggagatcgtcgtatctggagattctcacatggaacaggtacaatctggaagttggaatcatgaccgtgacgaaggtgaagatgaacaggttttgcagcccaagatcaagaggaagcgtagtattaggattcgccctcgtcataccatagaaaggcctgaagagaagtctggtagtgagacacaatctgtccaacggggagattcatctttgttacctttccaagcggaccataaatctcaagcacatataaggggtgatcctgaaatgaaaacatatggagaatccagtgctttgaagcatgaccaaagtgattcatcctcaaaaagtcgacgaaatttgcctacaaggagagctgctagtgcatcaaaattgcacccttcagccaaatctggcagattgaataacatgtctgatcctgcagatgctgctgatcactacagagaaaattgggaagggaaagttgggaatacaagtgggacttcaggttatgttacaaaaatgcctgacatcatacagagaaggtgcaagaatgttattagcaagctccagaggagaattgacaaggaaggtcctcaaatagtacctttactcacagatttgtggaagcggattgaaaattctggttacacaagtggatcggcaaataacatcttggatttacgaaaaattgatcagcgcatagagcggttagagtatagtggagtcatggagctcgtgtttgatgtccagtctatgttgaaaagttcaatgcaatattatgggttctcgcatgaggtacgaactgaagcgaggaaagtacatgatcttttctttgatatcttgaaaattgcctttgctgacactgactttcgagaagccagaagtgcactctcttttaccagcccagttgtgaccaccaatgctctatccccaagaccaggtgttggacaaagcaagagacacaaattgataaatgaggtggaacctgaccccagtcctctacagaagccactacggggacctattatcagtagcgaagaaacaagggtaagaagccatatgccccagaaggaatcaagacttgggagtggtagtggtaatagtcgggagcactatcagccagaggattctccattgcttgctcatccaggagatctggttatttgcaagaagaagagaaaagacagggaaaagactggggtaaagactaggaatggaccagctggccctgtttcaccccctagcatgggtcgcagtattagaagtcctggaccaaattcagtcccaagggagacaagatcaacccaacaggcatcacattcacaagggtgggccaaccagccttcgcagcctgctcagcccgcaaacaggggtacgggatccgttggttgggcaaatccggtaaagaggttaaggacggattctggaaagagaaggccaagccatttatga

Protein Analysis

2301

Amino Acids

257.79

Weight (kDa)

8.78

Isoelectric Point (pI)

58.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 4418
Acc36I ACCTGC 1 cut(s) 1099
AccB1I GGYRCC 2 cut(s) 1555, 3962
AccB7I CCANNNNNTGG 1 cut(s) 6398
AccBSI CCGCTC 1 cut(s) 6160
AccI GTMKAC 4 cut(s) 119, 2037, 5059, 5803
AcsI RAATTY 9 cut(s) 76, 217, 658, 674, 1417, 1713, 5809, 6091, 6730
AcvI CACGTG 1 cut(s) 3590
AcyI GRCGYC 1 cut(s) 122
AdeI CACNNNGTG 1 cut(s) 1538
AflII CTTAAG 1 cut(s) 3163
AflIII ACRYGT 1 cut(s) 5880
AhdI GACNNNNNGTC 1 cut(s) 649
AhlI ACTAGT 2 cut(s) 2816, 4931
AleI CACNNNNGTG 1 cut(s) 6781
Alw21I GWGCWC 4 cut(s) 966, 6189, 6343, 6567
Alw26I GTCTC 9 cut(s) 1397, 2357, 3162, 3394, 3782, 5033, 5645, 6406, 6740
Alw44I GTGCAC 1 cut(s) 6339
AlwNI CAGNNNCTG 6 cut(s) 1187, 1591, 2141, 2966, 2983, 5900
Ama87I CYCGRG 3 cut(s) 32, 43, 1510
ApaI GGGCCC 1 cut(s) 33
ApaLI GTGCAC 1 cut(s) 6339
ApoI RAATTY 9 cut(s) 76, 217, 658, 674, 1417, 1713, 5809, 6091, 6730
ArsI GACNNNNNNTTYG 4 cut(s) 713, 745, 2273, 2305
AseI ATTAAT 1 cut(s) 1887
Asp700I GAANNNNTTC 4 cut(s) 342, 1665, 2886, 3579
AspA2I CCTAGG 3 cut(s) 434, 1316, 1457
AspLEI GCGC 4 cut(s) 3455, 3621, 3878, 6153
AsuC2I CCSGG 5 cut(s) 33, 34, 44, 45, 408
AsuHPI GGTGA 9 cut(s) 223, 783, 1203, 1570, 1652, 2233, 5561, 5741, 6681
AsuII TTCGAA 1 cut(s) 4066
AsuNHI GCTAGC 2 cut(s) 695, 2554
AvaI CYCGRG 3 cut(s) 32, 43, 1510
AvrII CCTAGG 3 cut(s) 434, 1316, 1457
AxyI CCTNAGG 3 cut(s) 1551, 1656, 5338
BaeGI GKGCMC 2 cut(s) 33, 6343
BamHI GGATCC 3 cut(s) 4155, 4167, 6833
BanI GGYRCC 2 cut(s) 1555, 3962
BanII GRGCYC 5 cut(s) 33, 1511, 3189, 4477, 6189
BauI CACGAG 2 cut(s) 759, 6188
BbrPI CACGTG 1 cut(s) 3590
BbsI GAAGAC 2 cut(s) 1077, 3990
Bbv12I GWGCWC 4 cut(s) 966, 6189, 6343, 6567
BceAI ACGGC 5 cut(s) 79, 827, 1309, 3632, 3823
BcgI CGANNNNNNTGC 6 cut(s) 740, 774, 1451, 1485, 4056, 4090
BclI TGATCA 5 cut(s) 2470, 4858, 4906, 5905, 6145
BcnI CCSGG 5 cut(s) 33, 34, 44, 45, 408
BcoDI GTCTC 9 cut(s) 1397, 2357, 3162, 3394, 3782, 5033, 5645, 6406, 6740
BcuI ACTAGT 2 cut(s) 2816, 4931
BfmI CTRYAG 8 cut(s) 1703, 1962, 2034, 2958, 4320, 5892, 5911, 6455
BfoI RGCGCY 1 cut(s) 3622
BfrI CTTAAG 1 cut(s) 3163
BfuAI ACCTGC 1 cut(s) 1099
BglI GCCNNNNNGGC 2 cut(s) 1224, 2506
BglII AGATCT 3 cut(s) 2392, 3891, 6607
BlnI CCTAGG 3 cut(s) 434, 1316, 1457
BlpI GCTNAGC 1 cut(s) 6810
BmeRI GACNNNNNGTC 1 cut(s) 649
BmeT110I CYCGRG 3 cut(s) 32, 43, 1510
BmrI ACTGGG 3 cut(s) 6353, 6441, 6660
BmtI GCTAGC 2 cut(s) 699, 2558
BmuI ACTGGG 3 cut(s) 6353, 6441, 6660
BoxI GACNNNNGTC 1 cut(s) 6447
BpiI GAAGAC 2 cut(s) 1077, 3990
BplI GAGNNNNNCTC 4 cut(s) 1129, 1161, 4705, 4737
BpmI CTGGAG 9 cut(s) 1077, 1743, 3042, 4385, 4593, 5130, 5208, 5511, 6005
Bpu10I CCTNAGC 4 cut(s) 1228, 2867, 3848, 3995
Bpu1102I GCTNAGC 1 cut(s) 6810
Bpu14I TTCGAA 1 cut(s) 4066
BpuEI CTTGAG 5 cut(s) 980, 1107, 3426, 3806, 5697
BpuMI CCSGG 5 cut(s) 33, 34, 44, 45, 408
BsaAI YACGTR 1 cut(s) 3590
BsaBI GATNNNNATC 2 cut(s) 3603, 4434
BsaHI GRCGYC 1 cut(s) 122
BsaI GGTCTC 2 cut(s) 1397, 2357
BsaWI WCCGGW 2 cut(s) 3763, 6853
Bse118I RCCGGY 1 cut(s) 55
Bse21I CCTNAGG 3 cut(s) 1551, 1656, 5338
Bse3DI GCAATG 8 cut(s) 299, 588, 1439, 2220, 2502, 3641, 4802, 6587
Bse8I GATNNNNATC 2 cut(s) 3603, 4434
BseJI GATNNNNATC 2 cut(s) 3603, 4434
BseMI GCAATG 8 cut(s) 299, 588, 1439, 2220, 2502, 3641, 4802, 6587
BseRI GAGGAG 8 cut(s) 30, 33, 36, 1110, 1134, 1539, 4904, 6040
BseSI GKGCMC 2 cut(s) 33, 6343
BseYI CCCAGC 3 cut(s) 831, 2121, 4697
BsgI GTGCAG 5 cut(s) 167, 2588, 2655, 2952, 4398
BshNI GGYRCC 2 cut(s) 1555, 3962
BsiHKAI GWGCWC 4 cut(s) 966, 6189, 6343, 6567
BsiHKCI CYCGRG 3 cut(s) 32, 43, 1510
BsiSI CCGG 6 cut(s) 33, 44, 56, 408, 3764, 6854
BslFI GGGAC 4 cut(s) 75, 5965, 6486, 6722
BsmAI GTCTC 9 cut(s) 1397, 2357, 3162, 3394, 3782, 5033, 5645, 6406, 6740
BsmFI GGGAC 4 cut(s) 75, 5965, 6486, 6722
BsmI GAATGC 2 cut(s) 1905, 3067
Bso31I GGTCTC 2 cut(s) 1397, 2357
BsoBI CYCGRG 3 cut(s) 32, 43, 1510
Bsp119I TTCGAA 1 cut(s) 4066
Bsp120I GGGCCC 1 cut(s) 29
Bsp1286I GDGCHC 8 cut(s) 33, 966, 1511, 3189, 4477, 6189, 6343, 6567
Bsp1407I TGTACA 3 cut(s) 1075, 3262, 4272
Bsp1720I GCTNAGC 1 cut(s) 6810
BspHI TCATGA 5 cut(s) 870, 2698, 3721, 4723, 5533
BspMAI CTGCAG 2 cut(s) 2962, 5896
BspMI ACCTGC 1 cut(s) 1099
BspOI GCTAGC 2 cut(s) 699, 2558
BspQI GCTCTTC 2 cut(s) 348, 4722
BspT104I TTCGAA 1 cut(s) 4066
BspT107I GGYRCC 2 cut(s) 1555, 3962
BspTI CTTAAG 1 cut(s) 3163
BspTNI GGTCTC 2 cut(s) 1397, 2357
BsrBI CCGCTC 1 cut(s) 6160
BsrDI GCAATG 8 cut(s) 299, 588, 1439, 2220, 2502, 3641, 4802, 6587
BsrFI RCCGGY 1 cut(s) 55
BsrGI TGTACA 3 cut(s) 1075, 3262, 4272
BssAI RCCGGY 1 cut(s) 55
BssNI GRCGYC 1 cut(s) 122
BssSI CACGAG 2 cut(s) 759, 6188
BssT1I CCWWGG 8 cut(s) 370, 434, 1316, 1387, 1457, 4026, 5064, 6740
Bst2BI CACGAG 2 cut(s) 759, 6188
BstACI GRCGYC 1 cut(s) 122
BstAFI CTTAAG 1 cut(s) 3163
BstAUI TGTACA 3 cut(s) 1075, 3262, 4272
BstBAI YACGTR 1 cut(s) 3590
BstBI TTCGAA 1 cut(s) 4066
BstH2I RGCGCY 1 cut(s) 3622
BstHHI GCGC 4 cut(s) 3455, 3621, 3878, 6153
BstMAI GTCTC 9 cut(s) 1397, 2357, 3162, 3394, 3782, 5033, 5645, 6406, 6740
BstNSI RCATGY 6 cut(s) 649, 904, 1598, 1772, 3113, 5884
BstPAI GACNNNNGTC 1 cut(s) 6447
BstSFI CTRYAG 8 cut(s) 1703, 1962, 2034, 2958, 4320, 5892, 5911, 6455
BstSLI GKGCMC 2 cut(s) 33, 6343
BstV2I GAAGAC 2 cut(s) 1077, 3990
BstX2I RGATCY 9 cut(s) 1245, 2392, 3891, 4136, 4155, 4167, 5435, 6607, 6833
BstXI CCANNNNNNTGG 2 cut(s) 1003, 4484
BstYI RGATCY 9 cut(s) 1245, 2392, 3891, 4136, 4155, 4167, 5435, 6607, 6833
Bsu36I CCTNAGG 3 cut(s) 1551, 1656, 5338
BtsI GCAGTG 1 cut(s) 4262
BveI ACCTGC 1 cut(s) 1099
CaiI CAGNNNCTG 6 cut(s) 1187, 1591, 2141, 2966, 2983, 5900
CciI TCATGA 5 cut(s) 870, 2698, 3721, 4723, 5533
CfoI GCGC 4 cut(s) 3455, 3621, 3878, 6153
Cfr10I RCCGGY 1 cut(s) 55
Cfr9I CCCGGG 2 cut(s) 32, 43
CseI GACGC 2 cut(s) 130, 2528
CsiI ACCWGGT 1 cut(s) 6391
DraI TTTAAA 1 cut(s) 3678
DraIII CACNNNGTG 1 cut(s) 1538
DrdI GACNNNNNNGTC 1 cut(s) 4418
DriI GACNNNNNGTC 1 cut(s) 649
DseDI GACNNNNNNGTC 1 cut(s) 4418
Eam1105I GACNNNNNGTC 1 cut(s) 649
EciI GGCGGA 1 cut(s) 52
Ecl136II GAGCTC 1 cut(s) 6187
Eco130I CCWWGG 8 cut(s) 370, 434, 1316, 1387, 1457, 4026, 5064, 6740
Eco147I AGGCCT 3 cut(s) 2509, 2573, 5629
Eco24I GRGCYC 5 cut(s) 33, 1511, 3189, 4477, 6189
Eco31I GGTCTC 2 cut(s) 1397, 2357
Eco32I GATATC 3 cut(s) 3605, 5150, 6292
Eco53kI GAGCTC 1 cut(s) 6187
Eco72I CACGTG 1 cut(s) 3590
Eco81I CCTNAGG 3 cut(s) 1551, 1656, 5338
Eco88I CYCGRG 3 cut(s) 32, 43, 1510
EcoICRI GAGCTC 1 cut(s) 6187
EcoO109I RGGNCCY 3 cut(s) 620, 6044, 6473
EcoRI GAATTC 2 cut(s) 76, 674
EcoRV GATATC 3 cut(s) 3605, 5150, 6292
EcoT14I CCWWGG 8 cut(s) 370, 434, 1316, 1387, 1457, 4026, 5064, 6740
EcoT22I ATGCAT 1 cut(s) 5160
EcoT38I GRGCYC 5 cut(s) 33, 1511, 3189, 4477, 6189
ErhI CCWWGG 8 cut(s) 370, 434, 1316, 1387, 1457, 4026, 5064, 6740
FalI AAGNNNNNCTT 8 cut(s) 522, 554, 2271, 2303, 3864, 3896, 5938, 5970
FaqI GGGAC 4 cut(s) 75, 5965, 6486, 6722
FauI CCCGC 4 cut(s) 52, 2107, 3849, 6823
FauNDI CATATG 3 cut(s) 2269, 5749, 6513
FbaI TGATCA 5 cut(s) 2470, 4858, 4906, 5905, 6145
FblI GTMKAC 4 cut(s) 119, 2037, 5059, 5803
FriOI GRGCYC 5 cut(s) 33, 1511, 3189, 4477, 6189
GlaI GCGC 4 cut(s) 3454, 3620, 3877, 6152
GsaI CCCAGC 3 cut(s) 835, 2125, 4701
GsuI CTGGAG 9 cut(s) 1077, 1743, 3042, 4385, 4593, 5130, 5208, 5511, 6005
HaeII RGCGCY 1 cut(s) 3622
HapII CCGG 6 cut(s) 33, 44, 56, 408, 3764, 6854
HgaI GACGC 2 cut(s) 130, 2528
HhaI GCGC 4 cut(s) 3455, 3621, 3878, 6153
Hin1I GRCGYC 1 cut(s) 122
Hin6I GCGC 4 cut(s) 3453, 3619, 3876, 6151
HinP1I GCGC 4 cut(s) 3453, 3619, 3876, 6151
HincII GTYRAC 6 cut(s) 120, 502, 3088, 4531, 5060, 5804
HindII GTYRAC 6 cut(s) 120, 502, 3088, 4531, 5060, 5804
HindIII AAGCTT 2 cut(s) 531, 2894
HpaII CCGG 6 cut(s) 33, 44, 56, 408, 3764, 6854
HphI GGTGA 9 cut(s) 223, 783, 1203, 1570, 1652, 2233, 5561, 5741, 6681
HpyCH4IV ACGT 4 cut(s) 71, 1996, 2452, 3589
HpySE526I ACGT 4 cut(s) 71, 1996, 2452, 3589
Hsp92I GRCGYC 1 cut(s) 122
HspAI GCGC 4 cut(s) 3453, 3619, 3876, 6151
KroI GCCGGC 1 cut(s) 55
KroNI GCCGGC 1 cut(s) 57
Ksp22I TGATCA 5 cut(s) 2470, 4858, 4906, 5905, 6145
LguI GCTCTTC 2 cut(s) 348, 4722
MabI ACCWGGT 1 cut(s) 6391
MaeII ACGT 4 cut(s) 71, 1996, 2452, 3589
MbiI CCGCTC 1 cut(s) 6160
MfeI CAATTG 2 cut(s) 194, 4629
MflI RGATCY 9 cut(s) 1245, 2392, 3891, 4136, 4155, 4167, 5435, 6607, 6833
MhlI GDGCHC 8 cut(s) 33, 966, 1511, 3189, 4477, 6189, 6343, 6567
MlyI GAGTC 8 cut(s) 277, 499, 1787, 2192, 3813, 4735, 5027, 6186
MmeI TCCRAC 6 cut(s) 2455, 5284, 5339, 5507, 5689, 6379
Mph1103I ATGCAT 1 cut(s) 5160
MroNI GCCGGC 1 cut(s) 55
MroXI GAANNNNTTC 4 cut(s) 342, 1665, 2886, 3579
MslI CAYNNNNRTG 7 cut(s) 419, 449, 1271, 4514, 4764, 5538, 6781
MspA1I CMGCKG 7 cut(s) 1012, 1591, 2915, 2963, 3011, 4382, 6677
MspCI CTTAAG 1 cut(s) 3163
MspI CCGG 6 cut(s) 33, 44, 56, 408, 3764, 6854
MunI CAATTG 2 cut(s) 194, 4629
Mva1269I GAATGC 2 cut(s) 1905, 3067
NaeI GCCGGC 1 cut(s) 57
NciI CCSGG 5 cut(s) 33, 34, 44, 45, 408
NdeI CATATG 3 cut(s) 2269, 5749, 6513
NgoMIV GCCGGC 1 cut(s) 55
NheI GCTAGC 2 cut(s) 695, 2554
NmuCI GTSAC 7 cut(s) 789, 1289, 1530, 3475, 3669, 5540, 6364
NsiI ATGCAT 1 cut(s) 5160
NspI RCATGY 6 cut(s) 649, 904, 1598, 1772, 3113, 5884
NspV TTCGAA 1 cut(s) 4066
OliI CACNNNNGTG 1 cut(s) 6781
PaeI GCATGC 1 cut(s) 904
PagI TCATGA 5 cut(s) 870, 2698, 3721, 4723, 5533
PceI AGGCCT 3 cut(s) 2509, 2573, 5629
PciI ACATGT 1 cut(s) 5880
PciSI GCTCTTC 2 cut(s) 348, 4722
PcsI WCGNNNNNNNCGW 5 cut(s) 77, 98, 104, 116, 2662
PctI GAATGC 2 cut(s) 1905, 3067
PdiI GCCGGC 1 cut(s) 57
PdmI GAANNNNTTC 4 cut(s) 342, 1665, 2886, 3579
PflMI CCANNNNNTGG 1 cut(s) 6398
PfoI TCCNGGA 4 cut(s) 1720, 4158, 6601, 6721
PleI GAGTC 8 cut(s) 276, 498, 1786, 2192, 3813, 4735, 5026, 6185
PmaCI CACGTG 1 cut(s) 3590
PmlI CACGTG 1 cut(s) 3590
PpsI GAGTC 8 cut(s) 276, 498, 1786, 2192, 3813, 4735, 5026, 6185
Ppu21I YACGTR 1 cut(s) 3590
PpuMI RGGWCCY 2 cut(s) 6044, 6473
PscI ACATGT 1 cut(s) 5880
PshAI GACNNNNGTC 1 cut(s) 6447
PshBI ATTAAT 1 cut(s) 1887
Psp124BI GAGCTC 1 cut(s) 6189
Psp5II RGGWCCY 2 cut(s) 6044, 6473
PspCI CACGTG 1 cut(s) 3590
PspFI CCCAGC 3 cut(s) 831, 2121, 4697
PspOMI GGGCCC 1 cut(s) 29
PspPPI RGGWCCY 2 cut(s) 6044, 6473
PstI CTGCAG 2 cut(s) 2962, 5896
PstNI CAGNNNCTG 6 cut(s) 1187, 1591, 2141, 2966, 2983, 5900
PsuI RGATCY 9 cut(s) 1245, 2392, 3891, 4136, 4155, 4167, 5435, 6607, 6833
PvuII CAGCTG 7 cut(s) 1012, 1591, 2915, 2963, 3011, 4382, 6677
RseI CAYNNNNRTG 7 cut(s) 419, 449, 1271, 4514, 4764, 5538, 6781
SacI GAGCTC 1 cut(s) 6189
SalI GTCGAC 3 cut(s) 118, 5058, 5802
SapI GCTCTTC 2 cut(s) 348, 4722
SchI GAGTC 8 cut(s) 277, 499, 1787, 2192, 3813, 4735, 5027, 6186
SduI GDGCHC 8 cut(s) 33, 966, 1511, 3189, 4477, 6189, 6343, 6567
SexAI ACCWGGT 1 cut(s) 6391
SfcI CTRYAG 8 cut(s) 1703, 1962, 2034, 2958, 4320, 5892, 5911, 6455
SfuI TTCGAA 1 cut(s) 4066
SmaI CCCGGG 2 cut(s) 34, 45
SmiMI CAYNNNNRTG 7 cut(s) 419, 449, 1271, 4514, 4764, 5538, 6781
SmlI CTYRAG 6 cut(s) 959, 1122, 3163, 3441, 3785, 5712
SmoI CTYRAG 6 cut(s) 959, 1122, 3163, 3441, 3785, 5712
SpeI ACTAGT 2 cut(s) 2816, 4931
SphI GCATGC 1 cut(s) 904
SrfI GCCCGGGC 1 cut(s) 34
SseBI AGGCCT 3 cut(s) 2509, 2573, 5629
SspI AATATT 8 cut(s) 970, 1732, 3231, 3831, 4654, 5008, 5117, 6230
SstI GAGCTC 1 cut(s) 6189
StuI AGGCCT 3 cut(s) 2509, 2573, 5629
StyI CCWWGG 8 cut(s) 370, 434, 1316, 1387, 1457, 4026, 5064, 6740
TaiI ACGT 4 cut(s) 74, 1999, 2455, 3592
TaqII GACCGA 3 cut(s) 795, 1843, 4629
TatI WGTACW 5 cut(s) 1075, 3262, 4272, 4934, 6271
TauI GCSGC 3 cut(s) 127, 2407, 3856
TseFI GTSAC 7 cut(s) 789, 1289, 1530, 3475, 3669, 5540, 6364
Tsp45I GTSAC 7 cut(s) 789, 1289, 1530, 3475, 3669, 5540, 6364
TspGWI ACGGA 5 cut(s) 3073, 3166, 3568, 6826, 6887
TspMI CCCGGG 2 cut(s) 32, 43
Van91I CCANNNNNTGG 1 cut(s) 6398
Vha464I CTTAAG 1 cut(s) 3163
VneI GTGCAC 1 cut(s) 6339
VspI ATTAAT 1 cut(s) 1887
XapI RAATTY 9 cut(s) 76, 217, 658, 674, 1417, 1713, 5809, 6091, 6730
XbaI TCTAGA 2 cut(s) 203, 1690
XceI RCATGY 6 cut(s) 649, 904, 1598, 1772, 3113, 5884
XmaI CCCGGG 2 cut(s) 32, 43
XmaJI CCTAGG 3 cut(s) 434, 1316, 1457
XmiI GTMKAC 4 cut(s) 119, 2037, 5059, 5803
XmnI GAANNNNTTC 4 cut(s) 342, 1665, 2886, 3579
Zsp2I ATGCAT 1 cut(s) 5160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.