Rmu_sc0013504.1_g000008

Polyadenylate-binding protein-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013504.1
Physical Location & Seq
Forward (+)
34177 .. 35313
1137 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013504.1_g000008.1.cds

Sequence Viewer

Length: 417 bp
atgctagattcctccatatcacaatctcgccgtggtgagatggagagagagctggagccgtggatccctgatgaagatgatccacgtcctgagttggaaaatatatttgatggacattggaataggaactgggatcaatttgaaacaaatgaagcattatttggggtaaaaagctcatttgatgaggaactttacacaacaaagcttgagaaaggtcctaaaatgagagagttggaaagggaagctttacgaatagcaagagaaattgagggtgaggatacccaggatctgcatgcagcagaggaaagaggcatgcagccgtatgaaaattttgatattgatgaggagaccagatactcctctgtttatcataatgaagcttcaatttcatttcctgtggttgcttgtaaatcttga

Protein Analysis

138

Amino Acids

16.26

Weight (kDa)

4.41

Isoelectric Point (pI)

52.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 58, 71, 74, 141, 294
AcsI RAATTY 1 cut(s) 328
AgsI TTSAA 2 cut(s) 143, 384
AjiI CACGTC 1 cut(s) 86
AjnI CCWGG 1 cut(s) 282
AjuI GAANNNNNNNTTGG 2 cut(s) 144, 176
AluBI AGCT 5 cut(s) 52, 174, 205, 245, 380
AluI AGCT 5 cut(s) 52, 174, 205, 245, 380
Alw26I GTCTC 1 cut(s) 341
AlwI GGATC 5 cut(s) 58, 71, 74, 141, 294
AlwNI CAGNNNCTG 1 cut(s) 289
ApeKI GCWGC 2 cut(s) 296, 316
ApoI RAATTY 1 cut(s) 328
AspS9I GGNCC 1 cut(s) 215
AsuHPI GGTGA 2 cut(s) 47, 284
AvaII GGWCC 1 cut(s) 215
BamHI GGATCC 1 cut(s) 63
BbvI GCAGC 2 cut(s) 308, 328
BccI CCATC 2 cut(s) 34, 104
BceAI ACGGC 3 cut(s) 15, 43, 304
BciT130I CCWGG 1 cut(s) 284
BciVI GTATCC 1 cut(s) 271
BcoDI GTCTC 1 cut(s) 341
BfaI CTAG 1 cut(s) 5
BfuI GTATCC 1 cut(s) 271
BisI GCNGC 2 cut(s) 297, 317
BlsI GCNGC 2 cut(s) 298, 318
Bme1390I CCNGG 1 cut(s) 284
Bme18I GGWCC 1 cut(s) 215
BmgBI CACGTC 1 cut(s) 86
BmgT120I GGNCC 1 cut(s) 215
BmiI GGNNCC 2 cut(s) 57, 65
BmrFI CCNGG 1 cut(s) 284
BmrI ACTGGG 1 cut(s) 139
BmuI ACTGGG 1 cut(s) 139
BpmI CTGGAG 1 cut(s) 74
BpuEI CTTGAG 1 cut(s) 227
BsaI GGTCTC 1 cut(s) 341
BsaJI CCNNGG 3 cut(s) 31, 59, 282
Bse1I ACTGG 1 cut(s) 134
BseBI CCWGG 1 cut(s) 284
BseDI CCNNGG 3 cut(s) 31, 59, 282
BseMII CTCAG 1 cut(s) 81
BseNI ACTGG 1 cut(s) 134
BseRI GAGGAG 2 cut(s) 349, 359
BseXI GCAGC 2 cut(s) 308, 328
BsmAI GTCTC 1 cut(s) 341
Bso31I GGTCTC 1 cut(s) 341
Bsp143I GATC 4 cut(s) 63, 79, 133, 286
BspCNI CTCAG 1 cut(s) 82
BspLI GGNNCC 2 cut(s) 57, 65
BspPI GGATC 5 cut(s) 58, 71, 74, 141, 294
BspTNI GGTCTC 1 cut(s) 341
BsrI ACTGG 1 cut(s) 134
BssECI CCNNGG 3 cut(s) 31, 59, 282
BssMI GATC 4 cut(s) 63, 79, 133, 286
Bst2UI CCWGG 1 cut(s) 284
BstC8I GCNNGC 2 cut(s) 294, 314
BstDEI CTNAG 1 cut(s) 90
BstDSI CCRYGG 2 cut(s) 31, 59
BstKTI GATC 4 cut(s) 66, 82, 136, 289
BstMAI GTCTC 1 cut(s) 341
BstMBI GATC 4 cut(s) 63, 79, 133, 286
BstNI CCWGG 1 cut(s) 284
BstNSI RCATGY 2 cut(s) 296, 316
BstSCI CCNGG 1 cut(s) 282
BstV1I GCAGC 2 cut(s) 308, 328
BstX2I RGATCY 2 cut(s) 63, 286
BstYI RGATCY 2 cut(s) 63, 286
BsuI GTATCC 1 cut(s) 271
BtgI CCRYGG 2 cut(s) 31, 59
BtrI CACGTC 1 cut(s) 86
Cac8I GCNNGC 2 cut(s) 294, 314
CaiI CAGNNNCTG 1 cut(s) 289
Cfr13I GGNCC 1 cut(s) 215
CviAII CATG 2 cut(s) 293, 313
CviJI RGCY 7 cut(s) 52, 58, 174, 205, 245, 319, 380
CviKI_1 RGCY 7 cut(s) 52, 58, 174, 205, 245, 319, 380
DdeI CTNAG 1 cut(s) 90
DpnI GATC 4 cut(s) 65, 81, 135, 288
DpnII GATC 4 cut(s) 63, 79, 133, 286
Eco31I GGTCTC 1 cut(s) 341
Eco47I GGWCC 1 cut(s) 215
EcoO109I RGGNCCY 1 cut(s) 215
EcoRII CCWGG 1 cut(s) 282
FaeI CATG 2 cut(s) 296, 316
FaiI YATR 6 cut(s) 17, 104, 294, 314, 324, 372
FalI AAGNNNNNCTT 2 cut(s) 229, 261
FatI CATG 2 cut(s) 292, 312
Fnu4HI GCNGC 2 cut(s) 297, 317
Fsp4HI GCNGC 2 cut(s) 297, 317
FspBI CTAG 1 cut(s) 5
GluI GCNGC 2 cut(s) 297, 317
GsuI CTGGAG 1 cut(s) 74
Hin1II CATG 2 cut(s) 296, 316
HindIII AAGCTT 3 cut(s) 203, 243, 378
HinfI GANTC 1 cut(s) 8
HphI GGTGA 2 cut(s) 47, 284
Hpy188III TCNNGA 2 cut(s) 89, 414
HpyCH4IV ACGT 1 cut(s) 85
HpyCH4V TGCA 3 cut(s) 292, 296, 316
HpyF3I CTNAG 1 cut(s) 90
HpySE526I ACGT 1 cut(s) 85
Hsp92II CATG 2 cut(s) 296, 316
Kzo9I GATC 4 cut(s) 63, 79, 133, 286
LmnI GCTCC 1 cut(s) 55
LpnPI CCDG 8 cut(s) 38, 81, 102, 115, 269, 296, 364, 408
Lsp1109I GCAGC 2 cut(s) 308, 328
MaeI CTAG 1 cut(s) 5
MaeII ACGT 1 cut(s) 85
MalI GATC 4 cut(s) 65, 81, 135, 288
MboI GATC 4 cut(s) 63, 79, 133, 286
MboII GAAGA 1 cut(s) 86
MflI RGATCY 2 cut(s) 63, 286
MluCI AATT 4 cut(s) 137, 264, 328, 384
MmeI TCCRAC 2 cut(s) 75, 213
MnlI CCTC 8 cut(s) 22, 178, 262, 268, 295, 302, 337, 370
MspR9I CCNGG 1 cut(s) 284
MvaI CCWGG 1 cut(s) 284
NdeII GATC 4 cut(s) 63, 79, 133, 286
NlaIII CATG 2 cut(s) 296, 316
NlaIV GGNNCC 2 cut(s) 57, 65
NspI RCATGY 2 cut(s) 296, 316
PaeI GCATGC 2 cut(s) 296, 316
PfeI GAWTC 1 cut(s) 8
PkrI GCNGC 2 cut(s) 298, 318
PpuMI RGGWCCY 1 cut(s) 215
Psp5II RGGWCCY 1 cut(s) 215
Psp6I CCWGG 1 cut(s) 282
PspGI CCWGG 1 cut(s) 282
PspN4I GGNNCC 2 cut(s) 57, 65
PspPI GGNCC 1 cut(s) 215
PspPPI RGGWCCY 1 cut(s) 215
PstNI CAGNNNCTG 1 cut(s) 289
PsuI RGATCY 2 cut(s) 63, 286
SatI GCNGC 2 cut(s) 297, 317
Sau3AI GATC 4 cut(s) 63, 79, 133, 286
Sau96I GGNCC 1 cut(s) 215
ScrFI CCNGG 1 cut(s) 284
SetI ASST 7 cut(s) 54, 88, 176, 207, 217, 247, 382
SinI GGWCC 1 cut(s) 215
SmlI CTYRAG 1 cut(s) 206
SmoI CTYRAG 1 cut(s) 206
SphI GCATGC 2 cut(s) 296, 316
Sse9I AATT 4 cut(s) 137, 264, 328, 384
SspMI CTAG 1 cut(s) 5
StyD4I CCNGG 1 cut(s) 282
TaiI ACGT 1 cut(s) 88
TasI AATT 4 cut(s) 137, 264, 328, 384
TfiI GAWTC 1 cut(s) 8
TseI GCWGC 2 cut(s) 296, 316
TspDTI ATGAA 5 cut(s) 87, 165, 339, 378, 390
VpaK11BI GGWCC 1 cut(s) 215
XapI RAATTY 1 cut(s) 328
XceI RCATGY 2 cut(s) 296, 316
XspI CTAG 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.