Rmu_sc0020351.1_g000001

Polyadenylate-binding protein-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020351.1
Physical Location & Seq
Reverse (-)
1 .. 840
840 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020351.1_g000001.1.cds

Sequence Viewer

Length: 177 bp
atgagagagttggaaagggaagctttacgaatagcaagagaaattgagggtgaggatacccaggatctgcatgcagcagaggaaagaggcatgcagccgtatgaaaattttgatattgatgaggagaccagatactcctctgtttatcataacgaagcttcaatttcatttcctgtg

Protein Analysis

59

Amino Acids

6.97

Weight (kDa)

4.36

Isoelectric Point (pI)

47.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 72
AcsI RAATTY 1 cut(s) 106
AgsI TTSAA 1 cut(s) 162
AjnI CCWGG 1 cut(s) 60
AluBI AGCT 2 cut(s) 23, 158
AluI AGCT 2 cut(s) 23, 158
Alw26I GTCTC 1 cut(s) 119
AlwI GGATC 1 cut(s) 72
AlwNI CAGNNNCTG 1 cut(s) 67
ApeKI GCWGC 2 cut(s) 74, 94
ApoI RAATTY 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 62
BbvI GCAGC 2 cut(s) 86, 106
BceAI ACGGC 1 cut(s) 82
BciT130I CCWGG 1 cut(s) 62
BciVI GTATCC 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 119
BfuI GTATCC 1 cut(s) 49
BisI GCNGC 2 cut(s) 75, 95
BlsI GCNGC 2 cut(s) 76, 96
Bme1390I CCNGG 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 62
BsaI GGTCTC 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 60
BseBI CCWGG 1 cut(s) 62
BseDI CCNNGG 1 cut(s) 60
BseRI GAGGAG 2 cut(s) 127, 137
BseXI GCAGC 2 cut(s) 86, 106
BsmAI GTCTC 1 cut(s) 119
Bso31I GGTCTC 1 cut(s) 119
Bsp143I GATC 1 cut(s) 64
BspPI GGATC 1 cut(s) 72
BspTNI GGTCTC 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 60
BssMI GATC 1 cut(s) 64
Bst2UI CCWGG 1 cut(s) 62
BstC8I GCNNGC 2 cut(s) 72, 92
BstKTI GATC 1 cut(s) 67
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 1 cut(s) 64
BstNI CCWGG 1 cut(s) 62
BstNSI RCATGY 2 cut(s) 74, 94
BstSCI CCNGG 1 cut(s) 60
BstV1I GCAGC 2 cut(s) 86, 106
BstX2I RGATCY 1 cut(s) 64
BstYI RGATCY 1 cut(s) 64
BsuI GTATCC 1 cut(s) 49
Cac8I GCNNGC 2 cut(s) 72, 92
CaiI CAGNNNCTG 1 cut(s) 67
CviAII CATG 2 cut(s) 71, 91
CviJI RGCY 3 cut(s) 23, 97, 158
CviKI_1 RGCY 3 cut(s) 23, 97, 158
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
Eco31I GGTCTC 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 60
FaeI CATG 2 cut(s) 74, 94
FaiI YATR 4 cut(s) 72, 92, 102, 150
FalI AAGNNNNNCTT 2 cut(s) 7, 39
FatI CATG 2 cut(s) 70, 90
Fnu4HI GCNGC 2 cut(s) 75, 95
Fsp4HI GCNGC 2 cut(s) 75, 95
GluI GCNGC 2 cut(s) 75, 95
Hin1II CATG 2 cut(s) 74, 94
HindIII AAGCTT 2 cut(s) 21, 156
HphI GGTGA 1 cut(s) 62
HpyCH4V TGCA 3 cut(s) 70, 74, 94
Hsp92II CATG 2 cut(s) 74, 94
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 3 cut(s) 47, 74, 142
Lsp1109I GCAGC 2 cut(s) 86, 106
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MflI RGATCY 1 cut(s) 64
MluCI AATT 3 cut(s) 42, 106, 162
MnlI CCTC 6 cut(s) 40, 46, 73, 80, 115, 148
MspR9I CCNGG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 62
NdeII GATC 1 cut(s) 64
NlaIII CATG 2 cut(s) 74, 94
NspI RCATGY 2 cut(s) 74, 94
PaeI GCATGC 2 cut(s) 74, 94
PkrI GCNGC 2 cut(s) 76, 96
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
PstNI CAGNNNCTG 1 cut(s) 67
PsuI RGATCY 1 cut(s) 64
SatI GCNGC 2 cut(s) 75, 95
Sau3AI GATC 1 cut(s) 64
ScrFI CCNGG 1 cut(s) 62
SetI ASST 2 cut(s) 25, 160
SgeI CNNG 6 cut(s) 48, 73, 74, 83, 103, 141
SphI GCATGC 2 cut(s) 74, 94
Sse9I AATT 3 cut(s) 42, 106, 162
StyD4I CCNGG 1 cut(s) 60
TasI AATT 3 cut(s) 42, 106, 162
TseI GCWGC 2 cut(s) 74, 94
TspDTI ATGAA 2 cut(s) 117, 156
XapI RAATTY 1 cut(s) 106
XceI RCATGY 2 cut(s) 74, 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.