Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013978.1

Orthogroup ID

OG0005358

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1789

Gene Structure 1789 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013978.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 230 bp

atgctgagtttagagatactggattgaaaaggtctgaaaagttggcaaaagatttggagtggttcaaggagcaagtccatgccataccagaaccttttgctcctggtgtaaactatgctcagtatcttaaggaactattggagaaggatcgtcaagcatttttttgccacttctacaatatatacttcactcattcagctggtggacgaatgattgggaaaaaggtatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0004392 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006629 GO:0006720 GO:0006721 GO:0006725 GO:0006778 GO:0006787 GO:0006788 GO:0006807 GO:0007154 GO:0007165 GO:0007275 GO:0008150 GO:0008152 GO:0008299 GO:0008610 GO:0009056 GO:0009058 GO:0009314 GO:0009411 GO:0009416 GO:0009507 GO:0009536 GO:0009628 GO:0009648 GO:0009791 GO:0009812 GO:0009813 GO:0009888 GO:0009987 GO:0010019 GO:0010024 GO:0010073 GO:0010075 GO:0010119 GO:0010225 GO:0010228 GO:0010229 GO:0016108 GO:0016109 GO:0016114 GO:0016116 GO:0016117 GO:0016491 GO:0016705 GO:0018130 GO:0019438 GO:0019439 GO:0020037 GO:0022414 GO:0023052 GO:0032501 GO:0032502 GO:0033013 GO:0033014 GO:0033015 GO:0034641 GO:0034644 GO:0040008 GO:0042168 GO:0042440 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044248 GO:0044249 GO:0044255 GO:0044270 GO:0044271 GO:0044424 GO:0044444 GO:0044464 GO:0046148 GO:0046483 GO:0046700 GO:0046906 GO:0048037 GO:0048367 GO:0048507 GO:0048509 GO:0048573 GO:0048608 GO:0048638 GO:0048731 GO:0048856 GO:0050789 GO:0050793 GO:0050794 GO:0050896 GO:0051186 GO:0051187 GO:0051188 GO:0051202 GO:0051716 GO:0055114 GO:0061458 GO:0065007 GO:0071214 GO:0071478 GO:0071482 GO:0071494 GO:0071704 GO:0090567 GO:0097159 GO:0104004 GO:1901360 GO:1901361 GO:1901362 GO:1901363 GO:1901564 GO:1901565 GO:1901566 GO:1901575 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00860 ko01100 ko01110 map00860 map01100 map01110

Pfam Domains

Protein Families

Heme_oxygenase

Protein Analysis

75

Amino Acids

8.81

Weight (kDa)

8.78

Isoelectric Point (pI)

39.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005358)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G69720 AT1G69720 AT1G69720 AT2G26670 AT2G26670
fragaria_vesca	FvH4_1g03240
malus_domestica	MD02G1031400.v1.1 MD15G1173000.v1.1
prunus_persica	Prupe.7G243300_v2.0.a1
pyrus_communis	pycom02g02620 pycom15g15460
rosa_chinensis	RchiOBHm_Chr2g0088381
rosa_laevigata	RLG00000005088 RLG00000015948
rosa_multiflora	Rmu_sc0000039.1_g000009 Rmu_sc0004235.1_g000005 Rmu_sc0013978.1_g000001
rosa_roxburghii	Rroxscaffold_2G00113580 Rroxscaffold_2G00113670 Rroxscaffold_2G00152710 Rroxscaffold_7G00191740
rosa_rugosa	Rorug01G0483700
rosa_samantha	Rh2AG038300 Rh2BG037600 Rh2CG038700 Rh2DG038300 Rh5BG543800 Rh5CG567200
rosa_wichuraiana	Rw2G003030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	155
AflII	CTTAAG	1 cut(s)	127
AgsI	TTSAA	2 cut(s)	27, 66
AjnI	CCWGG	1 cut(s)	102
AluBI	AGCT	1 cut(s)	199
AluI	AGCT	1 cut(s)	199
AlwI	GGATC	1 cut(s)	155
BciT130I	CCWGG	1 cut(s)	104
BfrI	CTTAAG	1 cut(s)	127
Bme1390I	CCNGG	1 cut(s)	104
BmrFI	CCNGG	1 cut(s)	104
Bse1I	ACTGG	1 cut(s)	24
BseBI	CCWGG	1 cut(s)	104
BseMII	CTCAG	1 cut(s)	133
BseNI	ACTGG	1 cut(s)	24
Bsp143I	GATC	1 cut(s)	147
BspCNI	CTCAG	1 cut(s)	132
BspPI	GGATC	1 cut(s)	155
BspTI	CTTAAG	1 cut(s)	127
BsrI	ACTGG	1 cut(s)	24
BssMI	GATC	1 cut(s)	147
Bst2UI	CCWGG	1 cut(s)	104
BstAFI	CTTAAG	1 cut(s)	127
BstDEI	CTNAG	2 cut(s)	5, 119
BstKTI	GATC	1 cut(s)	150
BstMBI	GATC	1 cut(s)	147
BstNI	CCWGG	1 cut(s)	104
BstSCI	CCNGG	1 cut(s)	102
CviAII	CATG	1 cut(s)	79
CviJI	RGCY	1 cut(s)	199
CviKI_1	RGCY	1 cut(s)	199
DdeI	CTNAG	2 cut(s)	5, 119
DpnI	GATC	1 cut(s)	149
DpnII	GATC	1 cut(s)	147
EcoRII	CCWGG	1 cut(s)	102
FaeI	CATG	1 cut(s)	82
FaiI	YATR	6 cut(s)	80, 85, 116, 181, 183, 228
FatI	CATG	1 cut(s)	78
Hin1II	CATG	1 cut(s)	82
Hpy166II	GTNNAC	2 cut(s)	111, 205
Hpy188I	TCNGA	1 cut(s)	36
Hpy8I	GTNNAC	2 cut(s)	111, 205
HpyAV	CCTTC	1 cut(s)	138
HpyF3I	CTNAG	2 cut(s)	5, 119
Hsp92II	CATG	1 cut(s)	82
Kzo9I	GATC	1 cut(s)	147
LmnI	GCTCC	2 cut(s)	69, 105
LpnPI	CCDG	5 cut(s)	5, 89, 101, 116, 185
MalI	GATC	1 cut(s)	149
MboI	GATC	1 cut(s)	147
MseI	TTAA	1 cut(s)	128
MspA1I	CMGCKG	1 cut(s)	199
MspCI	CTTAAG	1 cut(s)	127
MspR9I	CCNGG	1 cut(s)	104
MvaI	CCWGG	1 cut(s)	104
NdeII	GATC	1 cut(s)	147
NlaIII	CATG	1 cut(s)	82
Psp6I	CCWGG	1 cut(s)	102
PspGI	CCWGG	1 cut(s)	102
PvuII	CAGCTG	1 cut(s)	199
SaqAI	TTAA	1 cut(s)	128
Sau3AI	GATC	1 cut(s)	147
ScrFI	CCNGG	1 cut(s)	104
SetI	ASST	4 cut(s)	34, 96, 201, 227
SgeI	CNNG	9 cut(s)	32, 78, 85, 91, 100, 115, 116, 166, 212
SmlI	CTYRAG	1 cut(s)	127
SmoI	CTYRAG	1 cut(s)	127
StyD4I	CCNGG	1 cut(s)	102
Tru1I	TTAA	1 cut(s)	128
Tru9I	TTAA	1 cut(s)	128
Vha464I	CTTAAG	1 cut(s)	127

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.