Rmu_sc0020995.1_g000013

HORMA domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020995.1
Physical Location & Seq
Forward (+)
54625 .. 55212
588 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020995.1_g000013.1.cds

Sequence Viewer

Length: 378 bp
atgcttgtgttatcagctagtaactacagagatacatccacatgtggcgcactctactccattggatcagatatgacacgcatgagaataagagctaattcaactgaacacagtccaatgaagagtgagcagactacttcaatgagaaaggagcatggaaacacccccaccatccaggctcagcctaaaatttcaagagagagttatgcacctggtaatgatgaaaacagagcaaatggcaacataaactattgtgatgaagatgagaggatgatgtgcagtagtaggtcgacgcaagacaagcgttccaggaaaacaagcatggtcaaggagcctattcttcagtacacaaagcgccataaatctcaagctctctga

Protein Analysis

125

Amino Acids

14.21

Weight (kDa)

9.43

Isoelectric Point (pI)

46.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 290
AclWI GGATC 1 cut(s) 73
AcsI RAATTY 1 cut(s) 189
AcuI CTGAAG 1 cut(s) 326
AfaI GTAC 1 cut(s) 347
AflIII ACRYGT 1 cut(s) 41
AgsI TTSAA 3 cut(s) 102, 141, 195
AjnI CCWGG 3 cut(s) 174, 211, 308
AluBI AGCT 3 cut(s) 17, 95, 371
AluI AGCT 3 cut(s) 17, 95, 371
AlwI GGATC 1 cut(s) 73
ApoI RAATTY 1 cut(s) 189
AspLEI GCGC 2 cut(s) 50, 357
BccI CCATC 1 cut(s) 179
BciT130I CCWGG 3 cut(s) 176, 213, 310
BfaI CTAG 1 cut(s) 18
BfmI CTRYAG 1 cut(s) 25
BfoI RGCGCY 1 cut(s) 358
BlpI GCTNAGC 1 cut(s) 180
Bme1390I CCNGG 3 cut(s) 176, 213, 310
BmiI GGNNCC 1 cut(s) 333
BmrFI CCNGG 3 cut(s) 176, 213, 310
Bpu1102I GCTNAGC 1 cut(s) 180
BpuEI CTTGAG 1 cut(s) 351
BseBI CCWGG 3 cut(s) 176, 213, 310
BseGI GGATG 3 cut(s) 35, 171, 276
BseMII CTCAG 1 cut(s) 194
BsgI GTGCAG 1 cut(s) 298
Bsp143I GATC 1 cut(s) 65
Bsp1720I GCTNAGC 1 cut(s) 180
BspCNI CTCAG 1 cut(s) 193
BspLI GGNNCC 1 cut(s) 333
BspPI GGATC 1 cut(s) 73
BssMI GATC 1 cut(s) 65
Bst2UI CCWGG 3 cut(s) 176, 213, 310
Bst4CI ACNGT 1 cut(s) 113
Bst6I CTCTTC 1 cut(s) 116
BstDEI CTNAG 1 cut(s) 180
BstF5I GGATG 3 cut(s) 35, 171, 276
BstH2I RGCGCY 1 cut(s) 358
BstHHI GCGC 2 cut(s) 50, 357
BstKTI GATC 1 cut(s) 68
BstMBI GATC 1 cut(s) 65
BstMWI GCNNNNNNNGC 1 cut(s) 301
BstNI CCWGG 3 cut(s) 176, 213, 310
BstNSI RCATGY 1 cut(s) 45
BstSCI CCNGG 3 cut(s) 174, 211, 308
BstSFI CTRYAG 1 cut(s) 25
BtsCI GGATG 3 cut(s) 35, 171, 276
CfoI GCGC 2 cut(s) 50, 357
CseI GACGC 1 cut(s) 301
CsiI ACCWGGT 1 cut(s) 211
Csp6I GTAC 1 cut(s) 346
CviAII CATG 4 cut(s) 42, 82, 155, 322
CviJI RGCY 6 cut(s) 17, 95, 179, 184, 334, 371
CviKI_1 RGCY 6 cut(s) 17, 95, 179, 184, 334, 371
CviQI GTAC 1 cut(s) 346
DdeI CTNAG 1 cut(s) 180
DpnI GATC 1 cut(s) 67
DpnII GATC 1 cut(s) 65
Eam1104I CTCTTC 1 cut(s) 116
EarI CTCTTC 1 cut(s) 116
Eco57I CTGAAG 1 cut(s) 326
EcoRII CCWGG 3 cut(s) 174, 211, 308
FaeI CATG 4 cut(s) 45, 85, 158, 325
FaiI YATR 8 cut(s) 43, 74, 83, 156, 207, 245, 323, 360
FatI CATG 4 cut(s) 41, 81, 154, 321
FblI GTMKAC 1 cut(s) 290
FokI GGATG 3 cut(s) 22, 158, 283
FspBI CTAG 1 cut(s) 18
GlaI GCGC 2 cut(s) 49, 356
HaeII RGCGCY 1 cut(s) 358
HgaI GACGC 1 cut(s) 301
HhaI GCGC 2 cut(s) 50, 357
Hin1II CATG 4 cut(s) 45, 85, 158, 325
Hin6I GCGC 2 cut(s) 48, 355
HinP1I GCGC 2 cut(s) 48, 355
HincII GTYRAC 1 cut(s) 291
HindII GTYRAC 1 cut(s) 291
Hpy166II GTNNAC 2 cut(s) 291, 348
Hpy188I TCNGA 2 cut(s) 70, 377
Hpy188III TCNNGA 1 cut(s) 195
Hpy8I GTNNAC 2 cut(s) 291, 348
Hpy99I CGWCG 1 cut(s) 295
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 2 cut(s) 209, 279
HpyF10VI GCNNNNNNNGC 1 cut(s) 301
HpyF3I CTNAG 1 cut(s) 180
Hsp92II CATG 4 cut(s) 45, 85, 158, 325
HspAI GCGC 2 cut(s) 48, 355
Kzo9I GATC 1 cut(s) 65
LmnI GCTCC 2 cut(s) 151, 331
LpnPI CCDG 6 cut(s) 161, 188, 198, 225, 295, 322
MabI ACCWGGT 1 cut(s) 211
MaeI CTAG 1 cut(s) 18
MaeIII GTNAC 1 cut(s) 20
MalI GATC 1 cut(s) 67
MboI GATC 1 cut(s) 65
MboII GAAGA 3 cut(s) 133, 272, 332
MluCI AATT 2 cut(s) 97, 189
MnlI CCTC 1 cut(s) 261
MslI CAYNNNNRTG 1 cut(s) 40
MspR9I CCNGG 3 cut(s) 176, 213, 310
MvaI CCWGG 3 cut(s) 176, 213, 310
MwoI GCNNNNNNNGC 1 cut(s) 301
NdeII GATC 1 cut(s) 65
NlaIII CATG 4 cut(s) 45, 85, 158, 325
NlaIV GGNNCC 1 cut(s) 333
NspI RCATGY 1 cut(s) 45
PciI ACATGT 1 cut(s) 41
PfoI TCCNGGA 1 cut(s) 308
PscI ACATGT 1 cut(s) 41
Psp6I CCWGG 3 cut(s) 174, 211, 308
PspGI CCWGG 3 cut(s) 174, 211, 308
PspN4I GGNNCC 1 cut(s) 333
RsaI GTAC 1 cut(s) 347
RsaNI GTAC 1 cut(s) 346
RseI CAYNNNNRTG 1 cut(s) 40
SalI GTCGAC 1 cut(s) 289
Sau3AI GATC 1 cut(s) 65
ScrFI CCNGG 3 cut(s) 176, 213, 310
SetI ASST 5 cut(s) 19, 97, 214, 290, 373
SexAI ACCWGGT 1 cut(s) 211
SfcI CTRYAG 1 cut(s) 25
SmiMI CAYNNNNRTG 1 cut(s) 40
SmlI CTYRAG 1 cut(s) 366
SmoI CTYRAG 1 cut(s) 366
Sse9I AATT 2 cut(s) 97, 189
SspMI CTAG 1 cut(s) 18
StyD4I CCNGG 3 cut(s) 174, 211, 308
TaaI ACNGT 1 cut(s) 113
TaqI TCGA 1 cut(s) 290
TasI AATT 2 cut(s) 97, 189
TatI WGTACW 1 cut(s) 345
TspDTI ATGAA 3 cut(s) 134, 237, 273
XapI RAATTY 1 cut(s) 189
XceI RCATGY 1 cut(s) 45
XmiI GTMKAC 1 cut(s) 290
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.