Rmu_sc0025811.1_g000001
MYB Family

Myb/SANT-like DNA-binding domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0025811.1
Physical Location & Seq
Forward (+)
1 .. 537
537 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0025811.1_g000001.1.cds

Sequence Viewer

Length: 476 bp
aaccagcaaccaatgggaatgatgatcatccagctgaacacgaggaagggactccaaattttcatcaattggagccattgtccatcccgcaagaagtactgtcctcatcggaatctgaggaagcagatgatggtgtagatgataaagaaacaattcaacctattactcccagcactgctggcatccgcaaaagagggcgcaaaggcattgatgatgccattgcaggagctattttagagatggcagctgcatcaaagctgagaacagctgctatacagcaacgtgatgccagatataccatagctaattgtattaaagcactggatgagatgaaaggcgttgatgagcaactctattttgctgctcttgatctgttcaacaagcccactgcaagggagatgttcttgtctctcaaacacgacaagcgcttgatttggttgcagggcaagtgcagagcagctggtcctgttccctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

157

Amino Acids

17.18

Weight (kDa)

5.1

Isoelectric Point (pI)

30.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 88, 186
AcsI RAATTY 1 cut(s) 57
AfaI GTAC 1 cut(s) 98
AfeI AGCGCT 1 cut(s) 427
AfiI CCNNNNNNNGG 1 cut(s) 392
AgsI TTSAA 2 cut(s) 157, 378
AluBI AGCT 7 cut(s) 34, 229, 247, 258, 268, 304, 460
AluI AGCT 7 cut(s) 34, 229, 247, 258, 268, 304, 460
Alw26I GTCTC 1 cut(s) 413
Aor51HI AGCGCT 1 cut(s) 427
ApeKI GCWGC 5 cut(s) 244, 247, 268, 361, 457
ApoI RAATTY 1 cut(s) 57
Asp700I GAANNNNTTC 1 cut(s) 152
AspLEI GCGC 2 cut(s) 200, 428
AspS9I GGNCC 1 cut(s) 463
AvaII GGWCC 1 cut(s) 463
BauI CACGAG 1 cut(s) 40
BbvI GCAGC 5 cut(s) 234, 255, 256, 348, 469
BccI CCATC 3 cut(s) 91, 124, 234
BclI TGATCA 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 413
BfaI CTAG 1 cut(s) 474
BfoI RGCGCY 1 cut(s) 429
BisI GCNGC 5 cut(s) 245, 248, 269, 362, 458
BlsI GCNGC 5 cut(s) 246, 249, 270, 363, 459
BmcAI AGTACT 1 cut(s) 98
Bme18I GGWCC 1 cut(s) 463
BmgT120I GGNCC 1 cut(s) 463
BmiI GGNNCC 1 cut(s) 74
BmsI GCATC 4 cut(s) 191, 204, 259, 276
BsaBI GATNNNNATC 1 cut(s) 26
BsaXI ACNNNNNCTCC 2 cut(s) 64, 94
Bsc4I CCNNNNNNNGG 1 cut(s) 392
Bse1I ACTGG 1 cut(s) 326
Bse3DI GCAATG 1 cut(s) 218
Bse8I GATNNNNATC 1 cut(s) 26
BseGI GGATG 4 cut(s) 27, 83, 182, 330
BseJI GATNNNNATC 1 cut(s) 26
BseLI CCNNNNNNNGG 1 cut(s) 392
BseMI GCAATG 1 cut(s) 218
BseMII CTCAG 2 cut(s) 107, 250
BseNI ACTGG 1 cut(s) 326
BseXI GCAGC 5 cut(s) 234, 255, 256, 348, 469
BseYI CCCAGC 1 cut(s) 169
BsgI GTGCAG 1 cut(s) 471
BslFI GGGAC 1 cut(s) 63
BslI CCNNNNNNNGG 1 cut(s) 392
BsmAI GTCTC 1 cut(s) 413
BsmFI GGGAC 1 cut(s) 63
Bsp143I GATC 2 cut(s) 24, 369
BspACI CCGC 2 cut(s) 88, 186
BspCNI CTCAG 2 cut(s) 108, 251
BspLI GGNNCC 1 cut(s) 74
BsrDI GCAATG 1 cut(s) 218
BsrI ACTGG 1 cut(s) 326
BssMI GATC 2 cut(s) 24, 369
BssSI CACGAG 1 cut(s) 40
Bst2BI CACGAG 1 cut(s) 40
Bst4CI ACNGT 1 cut(s) 101
BstC8I GCNNGC 1 cut(s) 180
BstDEI CTNAG 2 cut(s) 116, 259
BstF5I GGATG 4 cut(s) 27, 83, 182, 330
BstH2I RGCGCY 1 cut(s) 429
BstHHI GCGC 2 cut(s) 200, 428
BstKTI GATC 2 cut(s) 27, 372
BstMAI GTCTC 1 cut(s) 413
BstMBI GATC 2 cut(s) 24, 369
BstMWI GCNNNNNNNGC 1 cut(s) 179
BstV1I GCAGC 5 cut(s) 234, 255, 256, 348, 469
BtsCI GGATG 4 cut(s) 27, 83, 182, 330
BtsI GCAGTG 2 cut(s) 173, 386
BtsIMutI CAGTG 3 cut(s) 173, 319, 386
Cac8I GCNNGC 1 cut(s) 180
CfoI GCGC 2 cut(s) 200, 428
Cfr13I GGNCC 1 cut(s) 463
Csp6I GTAC 1 cut(s) 97
CviJI RGCY 9 cut(s) 34, 75, 229, 247, 258, 268, 304, 384, 460
CviKI_1 RGCY 9 cut(s) 34, 75, 229, 247, 258, 268, 304, 384, 460
CviQI GTAC 1 cut(s) 97
DdeI CTNAG 2 cut(s) 116, 259
DpnI GATC 2 cut(s) 26, 371
DpnII GATC 2 cut(s) 24, 369
Eco47I GGWCC 1 cut(s) 463
Eco47III AGCGCT 1 cut(s) 427
FaiI YATR 3 cut(s) 274, 296, 301
FaqI GGGAC 1 cut(s) 63
FauI CCCGC 1 cut(s) 95
FbaI TGATCA 1 cut(s) 24
Fnu4HI GCNGC 5 cut(s) 245, 248, 269, 362, 458
FokI GGATG 4 cut(s) 14, 70, 169, 337
Fsp4HI GCNGC 5 cut(s) 245, 248, 269, 362, 458
FspBI CTAG 1 cut(s) 474
GlaI GCGC 2 cut(s) 199, 427
GluI GCNGC 5 cut(s) 245, 248, 269, 362, 458
GsaI CCCAGC 1 cut(s) 173
HaeII RGCGCY 1 cut(s) 429
HhaI GCGC 2 cut(s) 200, 428
Hin6I GCGC 2 cut(s) 198, 426
HinP1I GCGC 2 cut(s) 198, 426
HinfI GANTC 2 cut(s) 51, 112
Hpy188I TCNGA 2 cut(s) 111, 117
Hpy188III TCNNGA 1 cut(s) 367
HpyAV CCTTC 1 cut(s) 40
HpyCH4III ACNGT 1 cut(s) 101
HpyCH4IV ACGT 1 cut(s) 282
HpyCH4V TGCA 5 cut(s) 223, 250, 391, 441, 452
HpyF10VI GCNNNNNNNGC 1 cut(s) 179
HpyF3I CTNAG 2 cut(s) 116, 259
HpySE526I ACGT 1 cut(s) 282
HspAI GCGC 2 cut(s) 198, 426
Ksp22I TGATCA 1 cut(s) 24
Kzo9I GATC 2 cut(s) 24, 369
LmnI GCTCC 2 cut(s) 72, 226
LpnPI CCDG 9 cut(s) 17, 44, 164, 183, 209, 303, 307, 427, 446
Lsp1109I GCAGC 5 cut(s) 234, 255, 256, 348, 469
LweI GCATC 4 cut(s) 191, 204, 259, 276
MaeI CTAG 1 cut(s) 474
MaeII ACGT 1 cut(s) 282
MalI GATC 2 cut(s) 26, 371
MboI GATC 2 cut(s) 24, 369
MfeI CAATTG 1 cut(s) 67
MluCI AATT 4 cut(s) 57, 67, 152, 306
MlyI GAGTC 1 cut(s) 45
MnlI CCTC 4 cut(s) 36, 111, 114, 187
MroXI GAANNNNTTC 1 cut(s) 152
MseI TTAA 1 cut(s) 314
MspA1I CMGCKG 4 cut(s) 34, 247, 268, 460
MunI CAATTG 1 cut(s) 67
MwoI GCNNNNNNNGC 1 cut(s) 179
NdeII GATC 2 cut(s) 24, 369
NlaIV GGNNCC 1 cut(s) 74
PdmI GAANNNNTTC 1 cut(s) 152
PfeI GAWTC 1 cut(s) 112
PkrI GCNGC 5 cut(s) 246, 249, 270, 363, 459
PleI GAGTC 1 cut(s) 45
PpsI GAGTC 1 cut(s) 45
PspFI CCCAGC 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 74
PspPI GGNCC 1 cut(s) 463
PvuII CAGCTG 4 cut(s) 34, 247, 268, 460
RsaI GTAC 1 cut(s) 98
RsaNI GTAC 1 cut(s) 97
SaqAI TTAA 1 cut(s) 314
SatI GCNGC 5 cut(s) 245, 248, 269, 362, 458
Sau3AI GATC 2 cut(s) 24, 369
Sau96I GGNCC 1 cut(s) 463
ScaI AGTACT 1 cut(s) 98
SchI GAGTC 1 cut(s) 45
SetI ASST 9 cut(s) 36, 162, 231, 249, 260, 270, 285, 306, 462
SfaNI GCATC 4 cut(s) 191, 204, 259, 276
SinI GGWCC 1 cut(s) 463
Sse9I AATT 4 cut(s) 57, 67, 152, 306
SsiI CCGC 2 cut(s) 88, 186
SspMI CTAG 1 cut(s) 474
TaaI ACNGT 1 cut(s) 101
TaiI ACGT 1 cut(s) 285
TasI AATT 4 cut(s) 57, 67, 152, 306
TatI WGTACW 1 cut(s) 96
TfiI GAWTC 1 cut(s) 112
Tru1I TTAA 1 cut(s) 314
Tru9I TTAA 1 cut(s) 314
TscAI CASTG 3 cut(s) 180, 326, 393
TseI GCWGC 5 cut(s) 244, 247, 268, 361, 457
TspDTI ATGAA 2 cut(s) 52, 346
TspRI CASTG 3 cut(s) 180, 326, 393
VpaK11BI GGWCC 1 cut(s) 463
XapI RAATTY 1 cut(s) 57
XmnI GAANNNNTTC 1 cut(s) 152
XspI CTAG 1 cut(s) 474
ZrmI AGTACT 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.