Rmu_sc0028447.1_g000001

Belongs to the GPI family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028447.1
Physical Location & Seq
Reverse (-)
1 .. 3316
3316 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028447.1_g000001.1.cds

Sequence Viewer

Length: 522 bp
atggagcttcggtggccgatagaagctacggtggctcgtggggagctgcgatggcttggtcagtcatctcactccctcagcctctctaagctagctcctattcgtaatctcgaaccgctgaaccgccgacccacggctttgcttcgacccactggtgtggctatcactcaagaaaattcattattagacaacactgctagaattgagggctggttagctagattcccaatgtttgactgggttgggggaagaacatctgaaatgtctgcagttggtcttcttccagcagcgcttcagggaattgacacattgctgaagtttctgaatcataatgtcagagtatctgttaagaataatcctgccgccttgcttgctttatgctggtattgggctactgatggattgggatccaaggatatggttgttcttccttacatggacagcctattattatttagtcggtatttgcagcagttggtcatggaatctattgggaaagaatttgaccttgatagtaatcgg

Protein Analysis

174

Amino Acids

19.54

Weight (kDa)

7.9

Isoelectric Point (pI)

56.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 116, 124, 363
AclWI GGATC 2 cut(s) 402, 415
AcoI YGGCCR 1 cut(s) 14
AcsI RAATTY 2 cut(s) 175, 500
AcuI CTGAAG 2 cut(s) 278, 335
AfeI AGCGCT 1 cut(s) 291
AfiI CCNNNNNNNGG 1 cut(s) 133
AleI CACNNNNGTG 1 cut(s) 155
AluBI AGCT 6 cut(s) 7, 26, 46, 91, 95, 218
AluI AGCT 6 cut(s) 7, 26, 46, 91, 95, 218
AlwI GGATC 2 cut(s) 402, 415
Aor51HI AGCGCT 1 cut(s) 291
AoxI GGCC 1 cut(s) 14
ApeKI GCWGC 3 cut(s) 46, 287, 469
ApoI RAATTY 2 cut(s) 175, 500
AspLEI GCGC 1 cut(s) 292
AsuNHI GCTAGC 1 cut(s) 91
BamHI GGATCC 1 cut(s) 407
BauI CACGAG 1 cut(s) 36
BbsI GAAGAC 1 cut(s) 269
BbvCI CCTCAGC 1 cut(s) 77
BbvI GCAGC 3 cut(s) 33, 299, 481
BccI CCATC 2 cut(s) 45, 392
BceAI ACGGC 1 cut(s) 150
BfaI CTAG 3 cut(s) 92, 198, 219
BfmI CTRYAG 1 cut(s) 267
BfoI RGCGCY 1 cut(s) 293
BisI GCNGC 4 cut(s) 47, 288, 363, 470
BlsI GCNGC 4 cut(s) 48, 289, 364, 471
BmiI GGNNCC 1 cut(s) 409
BmrI ACTGGG 1 cut(s) 247
BmtI GCTAGC 1 cut(s) 95
BmuI ACTGGG 1 cut(s) 247
BpiI GAAGAC 1 cut(s) 269
Bpu10I CCTNAGC 1 cut(s) 77
BpuEI CTTGAG 1 cut(s) 153
BsaBI GATNNNNATC 2 cut(s) 406, 516
BsaJI CCNNGG 2 cut(s) 132, 411
BsaXI ACNNNNNCTCC 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 133
Bse1I ACTGG 2 cut(s) 157, 242
Bse3DI GCAATG 1 cut(s) 308
Bse8I GATNNNNATC 2 cut(s) 406, 516
BseDI CCNNGG 2 cut(s) 132, 411
BseJI GATNNNNATC 2 cut(s) 406, 516
BseLI CCNNNNNNNGG 1 cut(s) 133
BseMI GCAATG 1 cut(s) 308
BseMII CTCAG 1 cut(s) 91
BseNI ACTGG 2 cut(s) 157, 242
BseXI GCAGC 3 cut(s) 33, 299, 481
BshFI GGCC 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 133
BsnI GGCC 1 cut(s) 16
Bsp143I GATC 1 cut(s) 407
BspACI CCGC 3 cut(s) 116, 124, 363
BspANI GGCC 1 cut(s) 16
BspCNI CTCAG 1 cut(s) 90
BspLI GGNNCC 1 cut(s) 409
BspMAI CTGCAG 1 cut(s) 271
BspOI GCTAGC 1 cut(s) 95
BspPI GGATC 2 cut(s) 402, 415
BsrDI GCAATG 1 cut(s) 308
BsrI ACTGG 2 cut(s) 157, 242
BssECI CCNNGG 2 cut(s) 132, 411
BssMI GATC 1 cut(s) 407
BssSI CACGAG 1 cut(s) 36
BssT1I CCWWGG 1 cut(s) 411
Bst2BI CACGAG 1 cut(s) 36
Bst4CI ACNGT 1 cut(s) 31
BstC8I GCNNGC 2 cut(s) 93, 372
BstDEI CTNAG 2 cut(s) 77, 87
BstDSI CCRYGG 1 cut(s) 132
BstH2I RGCGCY 1 cut(s) 293
BstHHI GCGC 1 cut(s) 292
BstKTI GATC 1 cut(s) 410
BstMBI GATC 1 cut(s) 407
BstMWI GCNNNNNNNGC 4 cut(s) 13, 32, 52, 371
BstSFI CTRYAG 1 cut(s) 267
BstV1I GCAGC 3 cut(s) 33, 299, 481
BstV2I GAAGAC 1 cut(s) 269
BstX2I RGATCY 1 cut(s) 407
BstXI CCANNNNNNTGG 2 cut(s) 157, 418
BstYI RGATCY 1 cut(s) 407
BsuRI GGCC 1 cut(s) 16
BtgI CCRYGG 1 cut(s) 132
BtgZI GCGATG 1 cut(s) 64
BtsI GCAGTG 1 cut(s) 192
BtsIMutI CAGTG 2 cut(s) 150, 192
Cac8I GCNNGC 2 cut(s) 93, 372
CfoI GCGC 1 cut(s) 292
CviAII CATG 2 cut(s) 436, 481
DdeI CTNAG 2 cut(s) 77, 87
DpnI GATC 1 cut(s) 409
DpnII GATC 1 cut(s) 407
EaeI YGGCCR 1 cut(s) 14
Eco130I CCWWGG 1 cut(s) 411
Eco47III AGCGCT 1 cut(s) 291
Eco57I CTGAAG 2 cut(s) 278, 335
EcoT14I CCWWGG 1 cut(s) 411
ErhI CCWWGG 1 cut(s) 411
FaeI CATG 2 cut(s) 439, 484
FaiI YATR 5 cut(s) 330, 379, 419, 437, 482
FatI CATG 2 cut(s) 435, 480
Fnu4HI GCNGC 4 cut(s) 47, 288, 363, 470
Fsp4HI GCNGC 4 cut(s) 47, 288, 363, 470
FspBI CTAG 3 cut(s) 92, 198, 219
GlaI GCGC 1 cut(s) 291
GluI GCNGC 4 cut(s) 47, 288, 363, 470
HaeII RGCGCY 1 cut(s) 293
HaeIII GGCC 1 cut(s) 16
HhaI GCGC 1 cut(s) 292
Hin1II CATG 2 cut(s) 439, 484
Hin6I GCGC 1 cut(s) 290
HinP1I GCGC 1 cut(s) 290
HinfI GANTC 3 cut(s) 222, 325, 485
Hpy188I TCNGA 3 cut(s) 259, 324, 338
Hpy188III TCNNGA 2 cut(s) 110, 170
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 2 cut(s) 269, 469
HpyF10VI GCNNNNNNNGC 4 cut(s) 13, 32, 52, 371
HpyF3I CTNAG 2 cut(s) 77, 87
Hsp92II CATG 2 cut(s) 439, 484
HspAI GCGC 1 cut(s) 290
Kzo9I GATC 1 cut(s) 407
LmnI GCTCC 3 cut(s) 4, 43, 100
LpnPI CCDG 7 cut(s) 138, 196, 223, 281, 297, 367, 372
Lsp1109I GCAGC 3 cut(s) 33, 299, 481
MaeI CTAG 3 cut(s) 92, 198, 219
MalI GATC 1 cut(s) 409
MboI GATC 1 cut(s) 407
MboII GAAGA 4 cut(s) 261, 269, 272, 419
MflI RGATCY 1 cut(s) 407
MluCI AATT 4 cut(s) 175, 201, 300, 500
MnlI CCTC 3 cut(s) 86, 92, 199
MseI TTAA 1 cut(s) 348
MslI CAYNNNNRTG 1 cut(s) 155
MspA1I CMGCKG 1 cut(s) 118
MwoI GCNNNNNNNGC 4 cut(s) 13, 32, 52, 371
NdeII GATC 1 cut(s) 407
NheI GCTAGC 1 cut(s) 91
NlaIII CATG 2 cut(s) 439, 484
NlaIV GGNNCC 1 cut(s) 409
OliI CACNNNNGTG 1 cut(s) 155
PfeI GAWTC 3 cut(s) 222, 325, 485
PkrI GCNGC 4 cut(s) 48, 289, 364, 471
PspN4I GGNNCC 1 cut(s) 409
PstI CTGCAG 1 cut(s) 271
PsuI RGATCY 1 cut(s) 407
RseI CAYNNNNRTG 1 cut(s) 155
SaqAI TTAA 1 cut(s) 348
SatI GCNGC 4 cut(s) 47, 288, 363, 470
Sau3AI GATC 1 cut(s) 407
SetI ASST 7 cut(s) 9, 28, 48, 93, 97, 220, 510
SfcI CTRYAG 1 cut(s) 267
SmiMI CAYNNNNRTG 1 cut(s) 155
SmlI CTYRAG 1 cut(s) 168
SmoI CTYRAG 1 cut(s) 168
Sse9I AATT 4 cut(s) 175, 201, 300, 500
SsiI CCGC 3 cut(s) 116, 124, 363
SspMI CTAG 3 cut(s) 92, 198, 219
StyI CCWWGG 1 cut(s) 411
TaaI ACNGT 1 cut(s) 31
TaqI TCGA 2 cut(s) 111, 145
TasI AATT 4 cut(s) 175, 201, 300, 500
TauI GCSGC 1 cut(s) 365
TfiI GAWTC 3 cut(s) 222, 325, 485
Tru1I TTAA 1 cut(s) 348
Tru9I TTAA 1 cut(s) 348
TscAI CASTG 2 cut(s) 157, 199
TseI GCWGC 3 cut(s) 46, 287, 469
TspDTI ATGAA 1 cut(s) 168
TspRI CASTG 2 cut(s) 157, 199
XapI RAATTY 2 cut(s) 175, 500
XcmI CCANNNNNNNNNTGG 1 cut(s) 234
XspI CTAG 3 cut(s) 92, 198, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.