Rh1BG031000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
4171271 .. 4178329
7059 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG031000.1

Sequence Viewer

Length: 162 bp
ATGTTTTGTGGGTTCTTGGACTACTTGGATTTTCTGCCTGGAATTGAAGGGCTTGAGGGAGATGAAGGCGTGCCTATGGATTTGAATGTTGCTTCGACGTCGGAGGTGGAGTCGTCGGCGGCGACGGTGGCGATTCTGGCGGTAGAGTTGAAGCGGCGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.68

Weight (kDa)

4.05

Isoelectric Point (pI)

50.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 101
AciI CCGC 3 cut(s) 119, 140, 154
AcyI GRCGYC 1 cut(s) 98
AgsI TTSAA 3 cut(s) 47, 85, 151
AjnI CCWGG 1 cut(s) 37
AspLEI GCGC 1 cut(s) 159
BciT130I CCWGG 1 cut(s) 39
BfaI CTAG 1 cut(s) 160
BfoI RGCGCY 1 cut(s) 160
BisI GCNGC 2 cut(s) 120, 155
BlsI GCNGC 2 cut(s) 121, 156
Bme1390I CCNGG 1 cut(s) 39
BmrFI CCNGG 1 cut(s) 39
BpuEI CTTGAG 1 cut(s) 74
BsaHI GRCGYC 1 cut(s) 98
BsaXI ACNNNNNCTCC 2 cut(s) 95, 125
BseBI CCWGG 1 cut(s) 39
BspACI CCGC 3 cut(s) 119, 140, 154
BssNI GRCGYC 1 cut(s) 98
Bst2UI CCWGG 1 cut(s) 39
Bst4CI ACNGT 1 cut(s) 127
BstACI GRCGYC 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 71
BstH2I RGCGCY 1 cut(s) 160
BstHHI GCGC 1 cut(s) 159
BstMWI GCNNNNNNNGC 2 cut(s) 128, 137
BstNI CCWGG 1 cut(s) 39
BstSCI CCNGG 1 cut(s) 37
Cac8I GCNNGC 1 cut(s) 71
CfoI GCGC 1 cut(s) 159
CviJI RGCY 1 cut(s) 52
CviKI_1 RGCY 1 cut(s) 52
EcoRII CCWGG 1 cut(s) 37
FaiI YATR 1 cut(s) 77
Fnu4HI GCNGC 2 cut(s) 120, 155
Fsp4HI GCNGC 2 cut(s) 120, 155
FspBI CTAG 1 cut(s) 160
GlaI GCGC 1 cut(s) 158
GluI GCNGC 2 cut(s) 120, 155
HaeII RGCGCY 1 cut(s) 160
HhaI GCGC 1 cut(s) 159
Hin1I GRCGYC 1 cut(s) 98
Hin6I GCGC 1 cut(s) 157
HinP1I GCGC 1 cut(s) 157
HinfI GANTC 2 cut(s) 110, 133
Hpy188I TCNGA 1 cut(s) 103
Hpy99I CGWCG 4 cut(s) 100, 103, 118, 127
HpyAV CCTTC 2 cut(s) 41, 59
HpyCH4III ACNGT 1 cut(s) 127
HpyCH4IV ACGT 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 2 cut(s) 128, 137
HpySE526I ACGT 1 cut(s) 98
Hsp92I GRCGYC 1 cut(s) 98
HspAI GCGC 1 cut(s) 157
LpnPI CCDG 3 cut(s) 24, 51, 122
MaeI CTAG 1 cut(s) 160
MaeII ACGT 1 cut(s) 98
MluCI AATT 1 cut(s) 42
MlyI GAGTC 1 cut(s) 119
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 2 cut(s) 49, 97
MspR9I CCNGG 1 cut(s) 39
MvaI CCWGG 1 cut(s) 39
MwoI GCNNNNNNNGC 2 cut(s) 128, 137
PcsI WCGNNNNNNNCGW 1 cut(s) 119
PfeI GAWTC 1 cut(s) 133
PkrI GCNGC 2 cut(s) 121, 156
PleI GAGTC 1 cut(s) 118
PpsI GAGTC 1 cut(s) 118
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
SatI GCNGC 2 cut(s) 120, 155
SchI GAGTC 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 39
SetI ASST 2 cut(s) 101, 108
SgeI CNNG 7 cut(s) 28, 37, 50, 51, 65, 82, 149
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
Sse9I AATT 1 cut(s) 42
SsiI CCGC 3 cut(s) 119, 140, 154
SspMI CTAG 1 cut(s) 160
StyD4I CCNGG 1 cut(s) 37
TaaI ACNGT 1 cut(s) 127
TaiI ACGT 1 cut(s) 101
TaqI TCGA 1 cut(s) 95
TasI AATT 1 cut(s) 42
TauI GCSGC 2 cut(s) 122, 157
TfiI GAWTC 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 78
XspI CTAG 1 cut(s) 160
ZraI GACGTC 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.