Rmu_sc0029360.1_g000001

Protein of unknown function (DUF563)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0029360.1
Physical Location & Seq
Reverse (-)
1 .. 652
652 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0029360.1_g000001.1.cds

Sequence Viewer

Length: 284 bp
atgaggcacaacgaaggtgggatgtctagggatcagagaatggaggtttatgatctaatgcggtgtaaggccagggcttactgtaatgtgagttcggaaggggaagatcgtcggaggaagattggaatgacgttgctcatgaggacagggccgagatcgttcaagaacgagggtgcggtggttggggtctttgagaaagagtgtgccaaggttgacggttgccgcttggtggtggctcactccaacaaccttactttctgtgaccaggtgcacattcccttaac
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.81

Weight (kDa)

8.97

Isoelectric Point (pI)

44.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 61, 176, 223
AclWI GGATC 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 229
AgsI TTSAA 1 cut(s) 163
AjnI CCWGG 2 cut(s) 71, 264
Alw21I GWGCWC 1 cut(s) 273
Alw44I GTGCAC 1 cut(s) 269
AlwI GGATC 1 cut(s) 39
AoxI GGCC 2 cut(s) 69, 149
ApaLI GTGCAC 1 cut(s) 269
AspS9I GGNCC 1 cut(s) 149
BaeGI GKGCMC 1 cut(s) 273
Bbv12I GWGCWC 1 cut(s) 273
BciT130I CCWGG 2 cut(s) 73, 266
BfaI CTAG 1 cut(s) 27
BisI GCNGC 1 cut(s) 223
BlsI GCNGC 1 cut(s) 224
Bme1390I CCNGG 2 cut(s) 73, 266
BmgT120I GGNCC 1 cut(s) 149
BmrFI CCNGG 2 cut(s) 73, 266
BsaJI CCNNGG 2 cut(s) 72, 207
Bsc4I CCNNNNNNNGG 1 cut(s) 229
BseBI CCWGG 2 cut(s) 73, 266
BseDI CCNNGG 2 cut(s) 72, 207
BseGI GGATG 1 cut(s) 27
BseLI CCNNNNNNNGG 1 cut(s) 229
BseSI GKGCMC 1 cut(s) 273
BshFI GGCC 2 cut(s) 71, 151
BsiHKAI GWGCWC 1 cut(s) 273
BslI CCNNNNNNNGG 1 cut(s) 229
BsnI GGCC 2 cut(s) 71, 151
Bsp1286I GDGCHC 1 cut(s) 273
Bsp143I GATC 4 cut(s) 31, 52, 106, 155
BspACI CCGC 3 cut(s) 61, 176, 223
BspANI GGCC 2 cut(s) 71, 151
BspHI TCATGA 1 cut(s) 138
BspPI GGATC 1 cut(s) 39
BssECI CCNNGG 2 cut(s) 72, 207
BssMI GATC 4 cut(s) 31, 52, 106, 155
BssT1I CCWWGG 1 cut(s) 207
Bst2UI CCWGG 2 cut(s) 73, 266
Bst4CI ACNGT 2 cut(s) 83, 218
BstF5I GGATG 1 cut(s) 27
BstKTI GATC 4 cut(s) 34, 55, 109, 158
BstMBI GATC 4 cut(s) 31, 52, 106, 155
BstNI CCWGG 2 cut(s) 73, 266
BstSCI CCNGG 2 cut(s) 71, 264
BstSLI GKGCMC 1 cut(s) 273
BsuRI GGCC 2 cut(s) 71, 151
BtsCI GGATG 1 cut(s) 27
CciI TCATGA 1 cut(s) 138
Cfr13I GGNCC 1 cut(s) 149
CsiI ACCWGGT 1 cut(s) 264
CspCI CAANNNNNGTGG 1 cut(s) 33
CviAII CATG 1 cut(s) 139
CviJI RGCY 4 cut(s) 71, 77, 151, 236
CviKI_1 RGCY 4 cut(s) 71, 77, 151, 236
DpnI GATC 4 cut(s) 33, 54, 108, 157
DpnII GATC 4 cut(s) 31, 52, 106, 155
Eco130I CCWWGG 1 cut(s) 207
EcoRII CCWGG 2 cut(s) 71, 264
EcoT14I CCWWGG 1 cut(s) 207
ErhI CCWWGG 1 cut(s) 207
FaeI CATG 1 cut(s) 142
FaiI YATR 2 cut(s) 51, 140
FatI CATG 1 cut(s) 138
Fnu4HI GCNGC 1 cut(s) 223
FokI GGATG 1 cut(s) 34
Fsp4HI GCNGC 1 cut(s) 223
FspBI CTAG 1 cut(s) 27
GluI GCNGC 1 cut(s) 223
HaeIII GGCC 2 cut(s) 71, 151
Hin1II CATG 1 cut(s) 142
HincII GTYRAC 1 cut(s) 214
HindII GTYRAC 1 cut(s) 214
Hpy166II GTNNAC 2 cut(s) 214, 271
Hpy188I TCNGA 3 cut(s) 36, 97, 114
Hpy188III TCNNGA 2 cut(s) 139, 163
Hpy8I GTNNAC 2 cut(s) 214, 271
Hpy99I CGWCG 1 cut(s) 114
HpyAV CCTTC 2 cut(s) 8, 92
HpyCH4III ACNGT 2 cut(s) 83, 218
HpyCH4IV ACGT 1 cut(s) 131
HpyCH4V TGCA 1 cut(s) 271
HpySE526I ACGT 1 cut(s) 131
Hsp92II CATG 1 cut(s) 142
Kzo9I GATC 4 cut(s) 31, 52, 106, 155
LpnPI CCDG 5 cut(s) 58, 85, 132, 251, 278
MabI ACCWGGT 1 cut(s) 264
MaeI CTAG 1 cut(s) 27
MaeII ACGT 1 cut(s) 131
MaeIII GTNAC 1 cut(s) 260
MalI GATC 4 cut(s) 33, 54, 108, 157
MboI GATC 4 cut(s) 31, 52, 106, 155
MboII GAAGA 2 cut(s) 116, 130
MhlI GDGCHC 1 cut(s) 273
MmeI TCCRAC 2 cut(s) 92, 267
MnlI CCTC 4 cut(s) 37, 108, 135, 163
MseI TTAA 1 cut(s) 281
MspR9I CCNGG 2 cut(s) 73, 266
MvaI CCWGG 2 cut(s) 73, 266
NdeII GATC 4 cut(s) 31, 52, 106, 155
NlaIII CATG 1 cut(s) 142
NmeAIII GCCGAG 1 cut(s) 177
NmuCI GTSAC 1 cut(s) 260
PagI TCATGA 1 cut(s) 138
PkrI GCNGC 1 cut(s) 224
Psp6I CCWGG 2 cut(s) 71, 264
PspGI CCWGG 2 cut(s) 71, 264
PspPI GGNCC 1 cut(s) 149
PsrI GAACNNNNNNTAC 2 cut(s) 76, 108
SaqAI TTAA 1 cut(s) 281
SatI GCNGC 1 cut(s) 223
Sau3AI GATC 4 cut(s) 31, 52, 106, 155
Sau96I GGNCC 1 cut(s) 149
ScrFI CCNGG 2 cut(s) 73, 266
SduI GDGCHC 1 cut(s) 273
SetI ASST 6 cut(s) 19, 48, 134, 213, 252, 270
SexAI ACCWGGT 1 cut(s) 264
SsiI CCGC 3 cut(s) 61, 176, 223
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 2 cut(s) 71, 264
StyI CCWWGG 1 cut(s) 207
TaaI ACNGT 2 cut(s) 83, 218
TaiI ACGT 1 cut(s) 134
TauI GCSGC 1 cut(s) 225
Tru1I TTAA 1 cut(s) 281
Tru9I TTAA 1 cut(s) 281
TseFI GTSAC 1 cut(s) 260
Tsp45I GTSAC 1 cut(s) 260
VneI GTGCAC 1 cut(s) 269
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.