Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000067.1

Orthogroup ID

OG0004099

Physical Location & Seq

Genomic Coordinates Forward (+)

172296 .. 174352

Gene Structure 2057 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000067.1_g000045.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1422 bp

atgcttgaccctgaacaaatcatggaagtgaaaagcagtgccagaccactccacaaaccgaagagcttgagcccctcaataaccctactcctcataggcctctttttgctatctctcattctcatcctatttcatggcttttcttcactctccatctcttctgcttcatgggattttcagaaatggagaagtgaacttggtgccaacaacaatgatgctcgtgatgatcttaactcgaagctgcgagactcggttactttccttcctctcaaagacctgaggttcactaaaactgcaatggagggcaacacttggtttatgagctctttcaacgacgcatacgaggaaaatgaatcccaatacctctatttcccttcacaagcgtcaaagggaagacttctatgcatcaaaggtcatgaccaaaaagatggcaccaagaactcatatgccttggcatggcctcaaagtctaccaaactccaccacagtcttgaagggcctcacctttgtgtctgacacatactatgattatgtaaacttgtggcatggactctctgcaatggtcccttttgtgggttggtccatgaagaacaggtgtttgaagccaacgagatgggtgttgttccattggggagagctgagagacaaaatggggttgtggcttcagaacctaatggaagcaaacttagggaaagtgctgattgaagaaatgggaaaaggagaagggccttattgttttgagaaggctgttgtgatgagacataatgttgggaaaatgggcaaagagaagaagcgtcaagtgtctgacttattgagatgtagagcaagagtgttttgtggcataaatccttcaggcagagggaaagaggttggtgtgagtggggagccaattataaggctaactttgctaatgaggagaggttcaagatcattcaaggatccaacagctgtgattactatatttgcaagggagtgtgcattggtggatgggtgcttgttagaggttgttcagtctgaagaccaaagtttctgtgatcaggttagggtaatgaccaacacagatattcttgcatccccacatggagctcagctaacaaacatgctattcatggatagaaatagtagcataatggaattcttccctaaaggatggttggagcttgccggtcagtatgctcatcactggatggcagatcaatccggtatgaagcaccgaggtgcatggtgggatcctaatgctgaagaggaatgtcctgaccctaaacaacaactagaatgctttaacttctataaagatggcaaggtcggtcacaacgaaacctactttgcagggtgggctagaactgttctcaaccaagttcggataagcaagcagcaagccatgcagagttcacagagatattcaaatgtttgccaatgctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF563

Protein Analysis

473

Amino Acids

53.9

Weight (kDa)

8.6

Isoelectric Point (pI)

44.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004099)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G33590 AT4G33600
fragaria_vesca	FvH4_2g11820 FvH4_5g35970
malus_domestica	MD05G1047000.v1.1 MD08G1191500.v1.1 MD15G1380300.v1.1
prunus_persica	Prupe.1G526500_v2.0.a1 Prupe.8G066800_v2.0.a1
pyrus_communis	pycom15g34060
rosa_chinensis	RchiOBHm_Chr4g0390351 RchiOBHm_Chr7g0237711
rosa_laevigata	RLG00000000975 RLG00000009924
rosa_multiflora	Rmu_co8254707.1_g000001 Rmu_co8428079.1_g000001 Rmu_sc0029360.1_g000001 Rmu_sc0029361.1_g000001 Rmu_ssc0000067.1_g000045
rosa_roxburghii	Rroxscaffold_3G00223850 Rroxscaffold_5G00336450
rosa_rugosa	Rorug03G0330300 Rorug07G0306500
rosa_samantha	Rh4AG031800 Rh4BG026000 Rh4CG035000 Rh4DG027600 Rh7AG463300 Rh7BG433300 Rh7CG480200 Rh7DG449200
rosa_wichuraiana	Rw4G002530 Rw7G038330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	893
AccB1I	GGYRCC	2 cut(s)	200, 431
AccI	GTMKAC	1 cut(s)	469
AclWI	GGATC	4 cut(s)	932, 945, 1223, 1236
AcsI	RAATTY	1 cut(s)	1133
AcuI	CTGAAG	4 cut(s)	647, 834, 1035, 1260
AfiI	CCNNNNNNNGG	3 cut(s)	456, 571, 572
AgsI	TTSAA	7 cut(s)	331, 493, 601, 704, 924, 934, 1404
AleI	CACNNNNGTG	2 cut(s)	506, 1215
AluBI	AGCT	8 cut(s)	66, 241, 324, 637, 947, 1085, 1090, 1159
AluI	AGCT	8 cut(s)	66, 241, 324, 637, 947, 1085, 1090, 1159
Alw21I	GWGCWC	2 cut(s)	326, 1087
Alw26I	GTCTC	3 cut(s)	240, 636, 751
AlwI	GGATC	4 cut(s)	932, 945, 1223, 1236
AoxI	GGCC	4 cut(s)	97, 458, 496, 725
ApeKI	GCWGC	2 cut(s)	241, 1372
ApoI	RAATTY	1 cut(s)	1133
AspS9I	GGNCC	4 cut(s)	496, 562, 579, 725
AsuHPI	GGTGA	1 cut(s)	493
AvaII	GGWCC	2 cut(s)	562, 579
AxyI	CCTNAGG	1 cut(s)	278
BamHI	GGATCC	2 cut(s)	937, 1228
BanI	GGYRCC	2 cut(s)	200, 431
BanII	GRGCYC	3 cut(s)	74, 326, 1087
BauI	CACGAG	1 cut(s)	219
BbsI	GAAGAC	2 cut(s)	400, 1023
Bbv12I	GWGCWC	2 cut(s)	326, 1087
BbvI	GCAGC	2 cut(s)	228, 1384
BccI	CCATC	7 cut(s)	161, 422, 606, 980, 1143, 1180, 1289
BclI	TGATCA	1 cut(s)	1033
BcoDI	GTCTC	3 cut(s)	240, 636, 751
BfaI	CTAG	3 cut(s)	1271, 1338, 1420
BisI	GCNGC	2 cut(s)	242, 1373
BlpI	GCTNAGC	1 cut(s)	1086
BlsI	GCNGC	2 cut(s)	243, 1374
Bme18I	GGWCC	2 cut(s)	562, 579
BmgT120I	GGNCC	4 cut(s)	496, 562, 579, 725
BmiI	GGNNCC	6 cut(s)	202, 433, 564, 885, 939, 1230
BmsI	GCATC	3 cut(s)	205, 414, 1079
BpiI	GAAGAC	2 cut(s)	400, 1023
Bpu1102I	GCTNAGC	1 cut(s)	1086
BpuEI	CTTGAG	1 cut(s)	88
BsaJI	CCNNGG	2 cut(s)	450, 1213
BsaWI	WCCGGW	1 cut(s)	1199
Bsc4I	CCNNNNNNNGG	3 cut(s)	456, 571, 572
Bse118I	RCCGGY	1 cut(s)	1163
Bse1I	ACTGG	1 cut(s)	1187
Bse21I	CCTNAGG	1 cut(s)	278
Bse3DI	GCAATG	2 cut(s)	303, 564
BseDI	CCNNGG	2 cut(s)	450, 1213
BseGI	GGATG	5 cut(s)	123, 991, 1070, 1154, 1191
BseLI	CCNNNNNNNGG	3 cut(s)	456, 571, 572
BseMI	GCAATG	2 cut(s)	303, 564
BseMII	CTCAG	3 cut(s)	269, 629, 1100
BseNI	ACTGG	1 cut(s)	1187
BseRI	GAGGAG	2 cut(s)	80, 928
BseXI	GCAGC	2 cut(s)	228, 1384
BshFI	GGCC	4 cut(s)	99, 460, 498, 727
BshNI	GGYRCC	2 cut(s)	200, 431
BsiHKAI	GWGCWC	2 cut(s)	326, 1087
BsiSI	CCGG	2 cut(s)	1164, 1200
BslFI	GGGAC	1 cut(s)	548
BslI	CCNNNNNNNGG	3 cut(s)	456, 571, 572
BsmAI	GTCTC	3 cut(s)	240, 636, 751
BsmFI	GGGAC	1 cut(s)	548
BsmI	GAATGC	1 cut(s)	1280
BsnI	GGCC	4 cut(s)	99, 460, 498, 727
Bsp1286I	GDGCHC	3 cut(s)	74, 326, 1087
Bsp143I	GATC	6 cut(s)	226, 926, 937, 1033, 1192, 1228
Bsp1720I	GCTNAGC	1 cut(s)	1086
BspANI	GGCC	4 cut(s)	99, 460, 498, 727
BspCNI	CTCAG	3 cut(s)	270, 630, 1099
BspHI	TCATGA	1 cut(s)	415
BspLI	GGNNCC	6 cut(s)	202, 433, 564, 885, 939, 1230
BspPI	GGATC	4 cut(s)	932, 945, 1223, 1236
BspQI	GCTCTTC	1 cut(s)	56
BspT107I	GGYRCC	2 cut(s)	200, 431
BsrDI	GCAATG	2 cut(s)	303, 564
BsrFI	RCCGGY	1 cut(s)	1163
BsrI	ACTGG	1 cut(s)	1187
BssAI	RCCGGY	1 cut(s)	1163
BssECI	CCNNGG	2 cut(s)	450, 1213
BssMI	GATC	6 cut(s)	226, 926, 937, 1033, 1192, 1228
BssSI	CACGAG	1 cut(s)	219
BssT1I	CCWWGG	1 cut(s)	450
Bst2BI	CACGAG	1 cut(s)	219
Bst4CI	ACNGT	2 cut(s)	487, 1345
Bst6I	CTCTTC	3 cut(s)	56, 163, 1236
BstAPI	GCANNNNNTGC	1 cut(s)	1381
BstC8I	GCNNGC	3 cut(s)	1161, 1370, 1377
BstDEI	CTNAG	4 cut(s)	278, 638, 685, 1086
BstF5I	GGATG	5 cut(s)	123, 991, 1070, 1154, 1191
BstKTI	GATC	6 cut(s)	229, 929, 940, 1036, 1195, 1231
BstMAI	GTCTC	3 cut(s)	240, 636, 751
BstMBI	GATC	6 cut(s)	226, 926, 937, 1033, 1192, 1228
BstMWI	GCNNNNNNNGC	3 cut(s)	904, 1334, 1381
BstNSI	RCATGY	1 cut(s)	1102
BstV1I	GCAGC	2 cut(s)	228, 1384
BstV2I	GAAGAC	2 cut(s)	400, 1023
BstX2I	RGATCY	2 cut(s)	937, 1228
BstXI	CCANNNNNNTGG	2 cut(s)	428, 612
BstYI	RGATCY	2 cut(s)	937, 1228
Bsu36I	CCTNAGG	1 cut(s)	278
BsuRI	GGCC	4 cut(s)	99, 460, 498, 727
BtsCI	GGATG	5 cut(s)	123, 991, 1070, 1154, 1191
BtsI	GCAGTG	1 cut(s)	43
BtsIMutI	CAGTG	2 cut(s)	43, 1180
Cac8I	GCNNGC	3 cut(s)	1161, 1370, 1377
CciI	TCATGA	1 cut(s)	415
Cfr10I	RCCGGY	1 cut(s)	1163
Cfr13I	GGNCC	4 cut(s)	496, 562, 579, 725
CseI	GACGC	3 cut(s)	344, 372, 782
DdeI	CTNAG	4 cut(s)	278, 638, 685, 1086
DpnI	GATC	6 cut(s)	228, 928, 939, 1035, 1194, 1230
DpnII	GATC	6 cut(s)	226, 926, 937, 1033, 1192, 1228
Eam1104I	CTCTTC	3 cut(s)	56, 163, 1236
EarI	CTCTTC	3 cut(s)	56, 163, 1236
Ecl136II	GAGCTC	2 cut(s)	324, 1085
Eco130I	CCWWGG	1 cut(s)	450
Eco147I	AGGCCT	1 cut(s)	99
Eco24I	GRGCYC	3 cut(s)	74, 326, 1087
Eco47I	GGWCC	2 cut(s)	562, 579
Eco53kI	GAGCTC	2 cut(s)	324, 1085
Eco57I	CTGAAG	4 cut(s)	647, 834, 1035, 1260
Eco81I	CCTNAGG	1 cut(s)	278
EcoICRI	GAGCTC	2 cut(s)	324, 1085
EcoO109I	RGGNCCY	2 cut(s)	496, 725
EcoRI	GAATTC	1 cut(s)	1133
EcoT14I	CCWWGG	1 cut(s)	450
EcoT22I	ATGCAT	1 cut(s)	407
EcoT38I	GRGCYC	3 cut(s)	74, 326, 1087
ErhI	CCWWGG	1 cut(s)	450
FalI	AAGNNNNNCTT	2 cut(s)	886, 918
FaqI	GGGAC	1 cut(s)	548
FauNDI	CATATG	1 cut(s)	445
FbaI	TGATCA	1 cut(s)	1033
FblI	GTMKAC	1 cut(s)	469
Fnu4HI	GCNGC	2 cut(s)	242, 1373
FokI	GGATG	5 cut(s)	110, 998, 1057, 1161, 1198
FriOI	GRGCYC	3 cut(s)	74, 326, 1087
Fsp4HI	GCNGC	2 cut(s)	242, 1373
FspBI	CTAG	3 cut(s)	1271, 1338, 1420
GluI	GCNGC	2 cut(s)	242, 1373
HaeIII	GGCC	4 cut(s)	99, 460, 498, 727
HapII	CCGG	2 cut(s)	1164, 1200
HgaI	GACGC	3 cut(s)	344, 372, 782
HinfI	GANTC	3 cut(s)	248, 353, 549
HpaII	CCGG	2 cut(s)	1164, 1200
HphI	GGTGA	1 cut(s)	493
Hpy166II	GTNNAC	5 cut(s)	194, 285, 470, 535, 1391
Hpy188I	TCNGA	6 cut(s)	180, 514, 666, 805, 1015, 1362
Hpy188III	TCNNGA	5 cut(s)	221, 416, 490, 924, 1253
Hpy8I	GTNNAC	5 cut(s)	194, 285, 470, 535, 1391
Hpy99I	CGWCG	1 cut(s)	338
HpyAV	CCTTC	6 cut(s)	272, 384, 487, 716, 736, 858
HpyCH4III	ACNGT	2 cut(s)	487, 1345
HpyCH4V	TGCA	9 cut(s)	296, 405, 557, 965, 977, 1070, 1220, 1328, 1384
HpyF10VI	GCNNNNNNNGC	3 cut(s)	904, 1334, 1381
HpyF3I	CTNAG	4 cut(s)	278, 638, 685, 1086
Ksp22I	TGATCA	1 cut(s)	1033
Kzo9I	GATC	6 cut(s)	226, 926, 937, 1033, 1192, 1228
LguI	GCTCTTC	1 cut(s)	56
LmnI	GCTCC	3 cut(s)	883, 1082, 1156
Lsp1109I	GCAGC	2 cut(s)	228, 1384
LweI	GCATC	3 cut(s)	205, 414, 1079
MaeI	CTAG	3 cut(s)	1271, 1338, 1420
MaeIII	GTNAC	2 cut(s)	253, 1307
MalI	GATC	6 cut(s)	228, 928, 939, 1035, 1194, 1230
MboI	GATC	6 cut(s)	226, 926, 937, 1033, 1192, 1228
MflI	RGATCY	2 cut(s)	937, 1228
MhlI	GDGCHC	3 cut(s)	74, 326, 1087
MluCI	AATT	2 cut(s)	888, 1133
MlyI	GAGTC	2 cut(s)	242, 543
MmeI	TCCRAC	2 cut(s)	965, 1134
Mph1103I	ATGCAT	1 cut(s)	407
MseI	TTAA	2 cut(s)	231, 1281
MslI	CAYNNNNRTG	3 cut(s)	26, 506, 1215
MspA1I	CMGCKG	1 cut(s)	947
MspI	CCGG	2 cut(s)	1164, 1200
Mva1269I	GAATGC	1 cut(s)	1280
MwoI	GCNNNNNNNGC	3 cut(s)	904, 1334, 1381
NdeI	CATATG	1 cut(s)	445
NdeII	GATC	6 cut(s)	226, 926, 937, 1033, 1192, 1228
NlaIV	GGNNCC	6 cut(s)	202, 433, 564, 885, 939, 1230
NmuCI	GTSAC	1 cut(s)	1307
NsiI	ATGCAT	1 cut(s)	407
NspI	RCATGY	1 cut(s)	1102
OliI	CACNNNNGTG	2 cut(s)	506, 1215
PagI	TCATGA	1 cut(s)	415
PceI	AGGCCT	1 cut(s)	99
PciSI	GCTCTTC	1 cut(s)	56
PcsI	WCGNNNNNNNCGW	2 cut(s)	339, 1311
PctI	GAATGC	1 cut(s)	1280
PfeI	GAWTC	1 cut(s)	353
PkrI	GCNGC	2 cut(s)	243, 1374
PleI	GAGTC	2 cut(s)	242, 543
PpsI	GAGTC	2 cut(s)	242, 543
PsiI	TTATAA	1 cut(s)	893
Psp124BI	GAGCTC	2 cut(s)	326, 1087
PspN4I	GGNNCC	6 cut(s)	202, 433, 564, 885, 939, 1230
PspPI	GGNCC	4 cut(s)	496, 562, 579, 725
PsuI	RGATCY	2 cut(s)	937, 1228
PvuII	CAGCTG	1 cut(s)	947
RseI	CAYNNNNRTG	3 cut(s)	26, 506, 1215
SacI	GAGCTC	2 cut(s)	326, 1087
SapI	GCTCTTC	1 cut(s)	56
SaqAI	TTAA	2 cut(s)	231, 1281
SatI	GCNGC	2 cut(s)	242, 1373
Sau3AI	GATC	6 cut(s)	226, 926, 937, 1033, 1192, 1228
Sau96I	GGNCC	4 cut(s)	496, 562, 579, 725
SchI	GAGTC	2 cut(s)	242, 543
SduI	GDGCHC	3 cut(s)	74, 326, 1087
SfaNI	GCATC	3 cut(s)	205, 414, 1079
SinI	GGWCC	2 cut(s)	562, 579
SmiMI	CAYNNNNRTG	3 cut(s)	26, 506, 1215
SmlI	CTYRAG	1 cut(s)	67
SmoI	CTYRAG	1 cut(s)	67
Sse9I	AATT	2 cut(s)	888, 1133
SseBI	AGGCCT	1 cut(s)	99
SspMI	CTAG	3 cut(s)	1271, 1338, 1420
SstI	GAGCTC	2 cut(s)	326, 1087
StuI	AGGCCT	1 cut(s)	99
StyI	CCWWGG	1 cut(s)	450
TaaI	ACNGT	2 cut(s)	487, 1345
TaqI	TCGA	1 cut(s)	236
TaqII	GACCGA	1 cut(s)	1295
TasI	AATT	2 cut(s)	888, 1133
TfiI	GAWTC	1 cut(s)	353
Tru1I	TTAA	2 cut(s)	231, 1281
Tru9I	TTAA	2 cut(s)	231, 1281
TscAI	CASTG	2 cut(s)	43, 1187
TseFI	GTSAC	1 cut(s)	1307
TseI	GCWGC	2 cut(s)	241, 1372
Tsp45I	GTSAC	1 cut(s)	1307
TspDTI	ATGAA	6 cut(s)	122, 156, 366, 599, 1096, 1220
TspRI	CASTG	2 cut(s)	43, 1187
VpaK11BI	GGWCC	2 cut(s)	562, 579
XapI	RAATTY	1 cut(s)	1133
XceI	RCATGY	1 cut(s)	1102
XmiI	GTMKAC	1 cut(s)	469
XspI	CTAG	3 cut(s)	1271, 1338, 1420
Zsp2I	ATGCAT	1 cut(s)	407

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.