Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0034754.1

Orthogroup ID

OG0001667

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 626

Gene Structure 625 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0034754.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 511 bp

atgaattcttgcattcctgattggaactttgagggtgatctccctttaaccaatcaaaagaaacccttggggccagatcatgaactagtagagctgttatggagaaatgggcaggtagttttgcacagccaaacaaatcgaaaaccaggtcctaatcctaatgagtcgaggcaagttcagaaacatgatcaaataagggttggtgggttctatgggaactcaggtaatttgattcatgatgaggacgcagtctccatgatccaataccctatagaagattcctttgataaagagttttcccatttcttttctgaactgccttcctgtgattcacttgagattgaaaagccaatcaaacaatttggagaagagaagtttgttaagtttgatgcttctagtaccacccatcttgtttcctcttcaccccaacctaatgtgaagtcctctaccggtgtggcatatcctgaaaatccaatgcctcctccaagatttcagatcagtaatccaactg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0007154 GO:0007165 GO:0007275 GO:0007602 GO:0008150 GO:0008152 GO:0009058 GO:0009314 GO:0009416 GO:0009581 GO:0009582 GO:0009583 GO:0009585 GO:0009605 GO:0009628 GO:0009637 GO:0009639 GO:0009640 GO:0009642 GO:0009645 GO:0009692 GO:0009693 GO:0009704 GO:0009791 GO:0009889 GO:0009966 GO:0009987 GO:0010017 GO:0010114 GO:0010161 GO:0010244 GO:0010468 GO:0010556 GO:0010600 GO:0010646 GO:0010817 GO:0010928 GO:0019219 GO:0019222 GO:0023051 GO:0023052 GO:0031323 GO:0031326 GO:0032350 GO:0032501 GO:0032502 GO:0042445 GO:0042446 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043449 GO:0043450 GO:0044237 GO:0044249 GO:0044424 GO:0044464 GO:0046885 GO:0048583 GO:0048856 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051252 GO:0051606 GO:0051716 GO:0060255 GO:0065007 GO:0065008 GO:0071214 GO:0071478 GO:0071482 GO:0071489 GO:0071491 GO:0071704 GO:0080090 GO:0090354 GO:0097159 GO:0104004 GO:0140110 GO:1900673 GO:1900674 GO:1901363 GO:1901576 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

ko04075 map04075

Pfam Domains

Protein Families

HLH

Protein Analysis

170

Amino Acids

19.16

Weight (kDa)

5.17

Isoelectric Point (pI)

48.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001667)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G43010 AT2G43010 AT2G43010 AT2G43010 AT2G43010 AT3G59060 AT3G59060 AT3G59060 AT3G59060
fragaria_vesca	FvH4_6g38940 FvH4_6g38940 FvH4_6g38940 FvH4_6g38940 FvH4_6g38940 FvH4_6g38940 FvH4_6g38940 FvH4_6g38940 FvH4_6g38940 FvH4_6g38940 FvH4_6g38940 FvH4_6g38940 FvH4_6g38940
malus_domestica	MD09G1146000.v1.1 MD17G1132600.v1.1
prunus_persica	Prupe.3G179800_v2.0.a1 Prupe.3G179800_v2.0.a1 Prupe.3G179800_v2.0.a1 Prupe.3G179800_v2.0.a1 Prupe.3G179800_v2.0.a1 Prupe.3G179800_v2.0.a1 Prupe.3G179800_v2.0.a1
pyrus_communis	pycom09g06630 pycom17g12610
rosa_chinensis	RchiOBHm_Chr2g0152511
rosa_laevigata	RLG00000020642
rosa_multiflora	Rmu_sc0005366.1_g000001 Rmu_sc0027733.1_g000001 Rmu_sc0027737.1_g000001 Rmu_sc0034754.1_g000001
rosa_roxburghii	Rroxscaffold_2G00095640
rosa_rugosa	Rorug02G0434000 Rorug02G0434100 Rorug02G0434200
rosa_samantha	Rh2AG495400 Rh2BG507300 Rh2CG481500 Rh2CG481600 Rh2DG518600
rosa_wichuraiana	Rw2G040760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	103
AclWI	GGATC	1 cut(s)	253
AcsI	RAATTY	1 cut(s)	4
AfaI	GTAC	1 cut(s)	400
AgeI	ACCGGT	1 cut(s)	449
AgsI	TTSAA	1 cut(s)	344
AhlI	ACTAGT	1 cut(s)	85
AjnI	CCWGG	1 cut(s)	145
AluBI	AGCT	1 cut(s)	94
AluI	AGCT	1 cut(s)	94
Alw26I	GTCTC	1 cut(s)	256
AlwI	GGATC	1 cut(s)	253
AoxI	GGCC	1 cut(s)	71
ApoI	RAATTY	1 cut(s)	4
ArsI	GACNNNNNNTTYG	2 cut(s)	133, 165
AsiGI	ACCGGT	1 cut(s)	449
AspS9I	GGNCC	2 cut(s)	71, 149
AsuHPI	GGTGA	2 cut(s)	47, 414
AvaII	GGWCC	1 cut(s)	149
BccI	CCATC	1 cut(s)	414
BciT130I	CCWGG	1 cut(s)	147
BclI	TGATCA	1 cut(s)	187
BcoDI	GTCTC	1 cut(s)	256
BcuI	ACTAGT	1 cut(s)	85
BfaI	CTAG	2 cut(s)	86, 396
BfmI	CTRYAG	1 cut(s)	270
BfuAI	ACCTGC	1 cut(s)	103
Bme1390I	CCNGG	1 cut(s)	147
Bme18I	GGWCC	1 cut(s)	149
BmgT120I	GGNCC	2 cut(s)	71, 149
BmiI	GGNNCC	1 cut(s)	72
BmrFI	CCNGG	1 cut(s)	147
BmsI	GCATC	1 cut(s)	379
BpuEI	CTTGAG	1 cut(s)	356
BsaJI	CCNNGG	1 cut(s)	66
BsaWI	WCCGGW	1 cut(s)	449
BsaXI	ACNNNNNCTCC	2 cut(s)	236, 266
Bse118I	RCCGGY	1 cut(s)	449
BseBI	CCWGG	1 cut(s)	147
BseDI	CCNNGG	1 cut(s)	66
BseMII	CTCAG	1 cut(s)	234
BseRI	GAGGAG	1 cut(s)	471
BshFI	GGCC	1 cut(s)	73
BshTI	ACCGGT	1 cut(s)	449
BsiSI	CCGG	1 cut(s)	450
BsmAI	GTCTC	1 cut(s)	256
BsmI	GAATGC	1 cut(s)	12
BsnI	GGCC	1 cut(s)	73
Bsp143I	GATC	5 cut(s)	37, 76, 187, 258, 495
BspANI	GGCC	1 cut(s)	73
BspCNI	CTCAG	1 cut(s)	233
BspHI	TCATGA	2 cut(s)	79, 235
BspLI	GGNNCC	1 cut(s)	72
BspMI	ACCTGC	1 cut(s)	103
BspPI	GGATC	1 cut(s)	253
BsrFI	RCCGGY	1 cut(s)	449
BssAI	RCCGGY	1 cut(s)	449
BssECI	CCNNGG	1 cut(s)	66
BssMI	GATC	5 cut(s)	37, 76, 187, 258, 495
BssT1I	CCWWGG	1 cut(s)	66
Bst2UI	CCWGG	1 cut(s)	147
Bst6I	CTCTTC	2 cut(s)	363, 424
BstDEI	CTNAG	1 cut(s)	220
BstKTI	GATC	5 cut(s)	40, 79, 190, 261, 498
BstMAI	GTCTC	1 cut(s)	256
BstMBI	GATC	5 cut(s)	37, 76, 187, 258, 495
BstNI	CCWGG	1 cut(s)	147
BstSCI	CCNGG	1 cut(s)	145
BstSFI	CTRYAG	1 cut(s)	270
BsuRI	GGCC	1 cut(s)	73
BveI	ACCTGC	1 cut(s)	103
CciI	TCATGA	2 cut(s)	79, 235
Cfr10I	RCCGGY	1 cut(s)	449
Cfr13I	GGNCC	2 cut(s)	71, 149
CseI	GACGC	1 cut(s)	254
CsiI	ACCWGGT	1 cut(s)	145
Csp6I	GTAC	1 cut(s)	399
CspAI	ACCGGT	1 cut(s)	449
CspCI	CAANNNNNGTGG	2 cut(s)	391, 426
CviAII	CATG	4 cut(s)	80, 185, 236, 256
CviJI	RGCY	4 cut(s)	73, 94, 129, 349
CviKI_1	RGCY	4 cut(s)	73, 94, 129, 349
CviQI	GTAC	1 cut(s)	399
DdeI	CTNAG	1 cut(s)	220
DpnI	GATC	5 cut(s)	39, 78, 189, 260, 497
DpnII	GATC	5 cut(s)	37, 76, 187, 258, 495
Eam1104I	CTCTTC	2 cut(s)	363, 424
EarI	CTCTTC	2 cut(s)	363, 424
Eco130I	CCWWGG	1 cut(s)	66
Eco47I	GGWCC	1 cut(s)	149
EcoO109I	RGGNCCY	1 cut(s)	149
EcoRI	GAATTC	1 cut(s)	4
EcoRII	CCWGG	1 cut(s)	145
EcoT14I	CCWWGG	1 cut(s)	66
ErhI	CCWWGG	1 cut(s)	66
FaeI	CATG	4 cut(s)	83, 188, 239, 259
FaiI	YATR	8 cut(s)	81, 100, 186, 213, 237, 257, 272, 460
FalI	AAGNNNNNCTT	2 cut(s)	50, 82
FatI	CATG	4 cut(s)	79, 184, 235, 255
FbaI	TGATCA	1 cut(s)	187
FspBI	CTAG	2 cut(s)	86, 396
HaeIII	GGCC	1 cut(s)	73
HapII	CCGG	1 cut(s)	450
HgaI	GACGC	1 cut(s)	254
Hin1II	CATG	4 cut(s)	83, 188, 239, 259
HinfI	GANTC	4 cut(s)	164, 232, 278, 329
HpaII	CCGG	1 cut(s)	450
HphI	GGTGA	2 cut(s)	47, 414
Hpy188I	TCNGA	3 cut(s)	180, 313, 495
Hpy188III	TCNNGA	4 cut(s)	17, 80, 236, 464
HpyAV	CCTTC	1 cut(s)	330
HpyCH4V	TGCA	2 cut(s)	12, 124
HpyF3I	CTNAG	1 cut(s)	220
Hsp92II	CATG	4 cut(s)	83, 188, 239, 259
Ksp22I	TGATCA	1 cut(s)	187
Kzo9I	GATC	5 cut(s)	37, 76, 187, 258, 495
LpnPI	CCDG	9 cut(s)	30, 87, 98, 132, 159, 207, 337, 463, 477
LweI	GCATC	1 cut(s)	379
MabI	ACCWGGT	1 cut(s)	145
MaeI	CTAG	2 cut(s)	86, 396
MalI	GATC	5 cut(s)	39, 78, 189, 260, 497
MboI	GATC	5 cut(s)	37, 76, 187, 258, 495
MboII	GAAGA	3 cut(s)	287, 380, 411
MluCI	AATT	3 cut(s)	4, 226, 359
MlyI	GAGTC	1 cut(s)	173
MnlI	CCTC	7 cut(s)	25, 162, 235, 427, 454, 489, 492
MseI	TTAA	2 cut(s)	47, 381
MspI	CCGG	1 cut(s)	450
MspR9I	CCNGG	1 cut(s)	147
Mva1269I	GAATGC	1 cut(s)	12
MvaI	CCWGG	1 cut(s)	147
NdeII	GATC	5 cut(s)	37, 76, 187, 258, 495
NlaIII	CATG	4 cut(s)	83, 188, 239, 259
NlaIV	GGNNCC	1 cut(s)	72
PagI	TCATGA	2 cut(s)	79, 235
PctI	GAATGC	1 cut(s)	12
PfeI	GAWTC	3 cut(s)	232, 278, 329
PflFI	GACNNNGTC	1 cut(s)	248
PinAI	ACCGGT	1 cut(s)	449
PleI	GAGTC	1 cut(s)	172
PpsI	GAGTC	1 cut(s)	172
PpuMI	RGGWCCY	1 cut(s)	149
Psp5II	RGGWCCY	1 cut(s)	149
Psp6I	CCWGG	1 cut(s)	145
PspGI	CCWGG	1 cut(s)	145
PspN4I	GGNNCC	1 cut(s)	72
PspPI	GGNCC	2 cut(s)	71, 149
PspPPI	RGGWCCY	1 cut(s)	149
PsyI	GACNNNGTC	1 cut(s)	248
RsaI	GTAC	1 cut(s)	400
RsaNI	GTAC	1 cut(s)	399
SaqAI	TTAA	2 cut(s)	47, 381
Sau3AI	GATC	5 cut(s)	37, 76, 187, 258, 495
Sau96I	GGNCC	2 cut(s)	71, 149
SchI	GAGTC	1 cut(s)	173
ScrFI	CCNGG	1 cut(s)	147
SetI	ASST	5 cut(s)	96, 117, 151, 226, 433
SexAI	ACCWGGT	1 cut(s)	145
SfaNI	GCATC	1 cut(s)	379
SfcI	CTRYAG	1 cut(s)	270
SinI	GGWCC	1 cut(s)	149
SmlI	CTYRAG	1 cut(s)	335
SmoI	CTYRAG	1 cut(s)	335
SpeI	ACTAGT	1 cut(s)	85
Sse9I	AATT	3 cut(s)	4, 226, 359
SspMI	CTAG	2 cut(s)	86, 396
StyD4I	CCNGG	1 cut(s)	145
StyI	CCWWGG	1 cut(s)	66
TaqI	TCGA	2 cut(s)	139, 167
TasI	AATT	3 cut(s)	4, 226, 359
TfiI	GAWTC	3 cut(s)	232, 278, 329
Tru1I	TTAA	2 cut(s)	47, 381
Tru9I	TTAA	2 cut(s)	47, 381
TspDTI	ATGAA	3 cut(s)	17, 96, 224
Tth111I	GACNNNGTC	1 cut(s)	248
VpaK11BI	GGWCC	1 cut(s)	149
XapI	RAATTY	1 cut(s)	4
XspI	CTAG	2 cut(s)	86, 396

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.