Rmu_sc0043110.1_g000001

ABA/WDS induced protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0043110.1
Physical Location & Seq
Forward (+)
1502 .. 1930
429 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0043110.1_g000001.1.cds

Sequence Viewer

Length: 429 bp
atgtctggagagaagcaccaccacggcctcttccaccaccacaaggacaacgaggataaaccggttgaaacctccgcctacaaatcacagactacttacgaaggcggcggctacagcgagaccaccggttattccgctgagggagagggtggcaggtacaaaagtgagaccaccgacgcctatggctcagctgctcccggcggtggccgatacaccagcgagaccactggttacgtaaaggagggacacggtggcaagtacagcgagaccagaaccgaagcttatggcaccactgaatccggaatcgattacaagaaggaggagaagcaccacaaacatctcgaagaactcggcgggctcggtgctgctgctgctggagcttatgctttggtacaaattgaattaaccctacatatatttaaattctaa

Protein Analysis

142

Amino Acids

15.39

Weight (kDa)

5.85

Isoelectric Point (pI)

35.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 144
AccB1I GGYRCC 1 cut(s) 287
AccIII TCCGGA 1 cut(s) 299
AciI CCGC 6 cut(s) 75, 105, 108, 135, 201, 354
AcoI YGGCCR 1 cut(s) 205
AcsI RAATTY 1 cut(s) 422
AcyI GRCGYC 1 cut(s) 177
AfaI GTAC 3 cut(s) 158, 260, 393
AfiI CCNNNNNNNGG 2 cut(s) 43, 203
AgeI ACCGGT 2 cut(s) 61, 125
AgsI TTSAA 2 cut(s) 68, 401
AluBI AGCT 3 cut(s) 191, 281, 380
AluI AGCT 3 cut(s) 191, 281, 380
Alw26I GTCTC 4 cut(s) 113, 161, 215, 260
Aor13HI TCCGGA 1 cut(s) 299
AoxI GGCC 2 cut(s) 25, 205
ApeKI GCWGC 4 cut(s) 191, 365, 368, 371
ApoI RAATTY 1 cut(s) 422
AsiGI ACCGGT 2 cut(s) 61, 125
AsuC2I CCSGG 1 cut(s) 198
BaeI ACNNNNGTAYC 2 cut(s) 148, 181
BanI GGYRCC 1 cut(s) 287
BanII GRGCYC 1 cut(s) 360
BbvCI CCTCAGC 1 cut(s) 138
BbvI GCAGC 4 cut(s) 178, 352, 355, 358
BceAI ACGGC 1 cut(s) 40
BcnI CCSGG 1 cut(s) 198
BcoDI GTCTC 4 cut(s) 113, 161, 215, 260
BfmI CTRYAG 1 cut(s) 112
BfuAI ACCTGC 1 cut(s) 144
BisI GCNGC 6 cut(s) 106, 109, 192, 366, 369, 372
BlpI GCTNAGC 1 cut(s) 187
BlsI GCNGC 6 cut(s) 107, 110, 193, 367, 370, 373
Bme1390I CCNGG 1 cut(s) 198
BmiI GGNNCC 1 cut(s) 289
BmrFI CCNGG 1 cut(s) 198
BpmI CTGGAG 2 cut(s) 27, 396
Bpu10I CCTNAGC 1 cut(s) 138
Bpu1102I GCTNAGC 1 cut(s) 187
BpuMI CCSGG 1 cut(s) 198
Bsa29I ATCGAT 1 cut(s) 306
BsaAI YACGTR 1 cut(s) 235
BsaHI GRCGYC 1 cut(s) 177
BsaI GGTCTC 4 cut(s) 113, 161, 215, 260
BsaJI CCNNGG 1 cut(s) 22
BsaWI WCCGGW 3 cut(s) 61, 125, 299
Bsc4I CCNNNNNNNGG 2 cut(s) 43, 203
Bse118I RCCGGY 2 cut(s) 61, 125
Bse1I ACTGG 1 cut(s) 232
BseAI TCCGGA 1 cut(s) 299
BseCI ATCGAT 1 cut(s) 306
BseDI CCNNGG 1 cut(s) 22
BseLI CCNNNNNNNGG 2 cut(s) 43, 203
BseMII CTCAG 2 cut(s) 129, 201
BseNI ACTGG 1 cut(s) 232
BseRI GAGGAG 1 cut(s) 335
BseXI GCAGC 4 cut(s) 178, 352, 355, 358
BshFI GGCC 2 cut(s) 27, 207
BshNI GGYRCC 1 cut(s) 287
BshTI ACCGGT 2 cut(s) 61, 125
BshVI ATCGAT 1 cut(s) 306
BsiSI CCGG 4 cut(s) 62, 126, 198, 300
BslFI GGGAC 1 cut(s) 258
BslI CCNNNNNNNGG 2 cut(s) 43, 203
BsmAI GTCTC 4 cut(s) 113, 161, 215, 260
BsmFI GGGAC 1 cut(s) 258
BsnI GGCC 2 cut(s) 27, 207
Bso31I GGTCTC 4 cut(s) 113, 161, 215, 260
Bsp1286I GDGCHC 1 cut(s) 360
Bsp13I TCCGGA 1 cut(s) 299
Bsp1720I GCTNAGC 1 cut(s) 187
BspACI CCGC 6 cut(s) 75, 105, 108, 135, 201, 354
BspANI GGCC 2 cut(s) 27, 207
BspCNI CTCAG 2 cut(s) 130, 200
BspDI ATCGAT 1 cut(s) 306
BspEI TCCGGA 1 cut(s) 299
BspLI GGNNCC 1 cut(s) 289
BspMI ACCTGC 1 cut(s) 144
BspT107I GGYRCC 1 cut(s) 287
BspTNI GGTCTC 4 cut(s) 113, 161, 215, 260
BsrFI RCCGGY 2 cut(s) 61, 125
BsrI ACTGG 1 cut(s) 232
BssAI RCCGGY 2 cut(s) 61, 125
BssECI CCNNGG 1 cut(s) 22
BssNI GRCGYC 1 cut(s) 177
Bst4CI ACNGT 1 cut(s) 251
Bst6I CTCTTC 1 cut(s) 35
BstACI GRCGYC 1 cut(s) 177
BstBAI YACGTR 1 cut(s) 235
BstC8I GCNNGC 1 cut(s) 356
BstDEI CTNAG 2 cut(s) 138, 187
BstDSI CCRYGG 1 cut(s) 22
BstMAI GTCTC 4 cut(s) 113, 161, 215, 260
BstMWI GCNNNNNNNGC 4 cut(s) 114, 261, 371, 377
BstSCI CCNGG 1 cut(s) 196
BstSFI CTRYAG 1 cut(s) 112
BstSNI TACGTA 1 cut(s) 235
BstV1I GCAGC 4 cut(s) 178, 352, 355, 358
Bsu15I ATCGAT 1 cut(s) 306
BsuRI GGCC 2 cut(s) 27, 207
BsuTUI ATCGAT 1 cut(s) 306
BtgI CCRYGG 1 cut(s) 22
BtsIMutI CAGTG 2 cut(s) 225, 291
BveI ACCTGC 1 cut(s) 144
Cac8I GCNNGC 1 cut(s) 356
Cfr10I RCCGGY 2 cut(s) 61, 125
ClaI ATCGAT 1 cut(s) 306
CseI GACGC 1 cut(s) 185
Csp6I GTAC 3 cut(s) 157, 259, 392
CspAI ACCGGT 2 cut(s) 61, 125
CviJI RGCY 8 cut(s) 27, 111, 186, 191, 207, 281, 358, 380
CviKI_1 RGCY 8 cut(s) 27, 111, 186, 191, 207, 281, 358, 380
CviQI GTAC 3 cut(s) 157, 259, 392
DdeI CTNAG 2 cut(s) 138, 187
DraI TTTAAA 1 cut(s) 421
EaeI YGGCCR 1 cut(s) 205
Eam1104I CTCTTC 1 cut(s) 35
EarI CTCTTC 1 cut(s) 35
EciI GGCGGA 1 cut(s) 64
Eco105I TACGTA 1 cut(s) 235
Eco24I GRGCYC 1 cut(s) 360
Eco31I GGTCTC 4 cut(s) 113, 161, 215, 260
EcoT38I GRGCYC 1 cut(s) 360
FaiI YATR 5 cut(s) 183, 285, 384, 414, 416
FaqI GGGAC 1 cut(s) 258
FauI CCCGC 1 cut(s) 347
Fnu4HI GCNGC 6 cut(s) 106, 109, 192, 366, 369, 372
FriOI GRGCYC 1 cut(s) 360
Fsp4HI GCNGC 6 cut(s) 106, 109, 192, 366, 369, 372
GluI GCNGC 6 cut(s) 106, 109, 192, 366, 369, 372
GsuI CTGGAG 2 cut(s) 27, 396
HaeIII GGCC 2 cut(s) 27, 207
HapII CCGG 4 cut(s) 62, 126, 198, 300
HgaI GACGC 1 cut(s) 185
Hin1I GRCGYC 1 cut(s) 177
HindIII AAGCTT 1 cut(s) 279
HinfI GANTC 2 cut(s) 296, 303
HpaII CCGG 4 cut(s) 62, 126, 198, 300
Hpy188III TCNNGA 3 cut(s) 6, 300, 341
Hpy99I CGWCG 1 cut(s) 179
HpyAV CCTTC 2 cut(s) 95, 310
HpyCH4III ACNGT 1 cut(s) 251
HpyCH4IV ACGT 1 cut(s) 234
HpyF10VI GCNNNNNNNGC 4 cut(s) 114, 261, 371, 377
HpyF3I CTNAG 2 cut(s) 138, 187
HpySE526I ACGT 1 cut(s) 234
Hsp92I GRCGYC 1 cut(s) 177
Kpn2I TCCGGA 1 cut(s) 299
LmnI GCTCC 2 cut(s) 199, 377
LpnPI CCDG 9 cut(s) 75, 139, 139, 211, 213, 229, 283, 313, 360
Lsp1109I GCAGC 4 cut(s) 178, 352, 355, 358
MaeII ACGT 1 cut(s) 234
MaeIII GTNAC 1 cut(s) 230
MboII GAAGA 2 cut(s) 22, 356
MhlI GDGCHC 1 cut(s) 360
MluCI AATT 3 cut(s) 396, 401, 422
MnlI CCTC 7 cut(s) 38, 46, 82, 133, 139, 235, 313
MroI TCCGGA 1 cut(s) 299
MseI TTAA 2 cut(s) 404, 420
MspA1I CMGCKG 2 cut(s) 137, 191
MspI CCGG 4 cut(s) 62, 126, 198, 300
MspR9I CCNGG 1 cut(s) 198
MwoI GCNNNNNNNGC 4 cut(s) 114, 261, 371, 377
NciI CCSGG 1 cut(s) 198
NlaIV GGNNCC 1 cut(s) 289
NmeAIII GCCGAG 1 cut(s) 330
PfeI GAWTC 2 cut(s) 296, 303
PinAI ACCGGT 2 cut(s) 61, 125
PkrI GCNGC 6 cut(s) 107, 110, 193, 367, 370, 373
Ppu21I YACGTR 1 cut(s) 235
PspN4I GGNNCC 1 cut(s) 289
PvuII CAGCTG 1 cut(s) 191
RsaI GTAC 3 cut(s) 158, 260, 393
RsaNI GTAC 3 cut(s) 157, 259, 392
SaqAI TTAA 2 cut(s) 404, 420
SatI GCNGC 6 cut(s) 106, 109, 192, 366, 369, 372
ScrFI CCNGG 1 cut(s) 198
SduI GDGCHC 1 cut(s) 360
SetI ASST 6 cut(s) 74, 158, 193, 237, 283, 382
SfcI CTRYAG 1 cut(s) 112
SmiI ATTTAAAT 1 cut(s) 421
SnaBI TACGTA 1 cut(s) 235
Sse9I AATT 3 cut(s) 396, 401, 422
SsiI CCGC 6 cut(s) 75, 105, 108, 135, 201, 354
StyD4I CCNGG 1 cut(s) 196
SwaI ATTTAAAT 1 cut(s) 421
TaaI ACNGT 1 cut(s) 251
TaiI ACGT 1 cut(s) 237
TaqI TCGA 2 cut(s) 306, 342
TasI AATT 3 cut(s) 396, 401, 422
TatI WGTACW 1 cut(s) 258
TauI GCSGC 2 cut(s) 108, 111
TfiI GAWTC 2 cut(s) 296, 303
Tru1I TTAA 2 cut(s) 404, 420
Tru9I TTAA 2 cut(s) 404, 420
TscAI CASTG 2 cut(s) 232, 298
TseI GCWGC 4 cut(s) 191, 365, 368, 371
TspRI CASTG 2 cut(s) 232, 298
XapI RAATTY 1 cut(s) 422
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.