Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000027.1

Orthogroup ID

OG0003709

Physical Location & Seq

Genomic Coordinates Forward (+)

137489 .. 142546

Gene Structure 5058 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000027.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1791 bp

atggcatttggaggttctgtgttcttgtctatgctcctatctttggctgcagctgcttgcttctccgttggcacttccgatgcctattatatccctttcaaccgaagcagttttcctgctggattcctttttggtgctggttcagctgcttatcaggtaaaagcagtattcaacattatggcatttggaggttctgtgttcttgtctatgctcctatctttggctgcagctgcttgcttctccgttggcacttccgatgcttattatatcccttttaaccgaagcagttttcccactggattcctttttggtgccggttcagctgcttatcagtctgaaggagcagcatttctagatggaaggggacctagcatctgggatactttcgttaggaaacatccagaaaaaatatgggatcacagcacgggagacgtagctgatgacttttatcaccattataaggaggatataaagttgatgaagaaaattgggttggactctttcagattctcaatttcatggcccagattacttcccaagggaaaacttagtggaggagtgaacccacttggtgtcaaattctacaataatctcatcaacgagctcgtatccaatgagggaaaacttagtggaggagtgaacccacttggtgtcaaattctacaataatctcatcaacgagctcgtatccaatggtatcaagcccttggtgactttgctccattatgatcctccccaagcacttgatgatctgtatggcgggttcttaagccctaacataataaatgattatggagattatgtggatttctgcttcaagacatttggtgatcgagtgaagcactgggtcacaatgaacgaaccaaacggatttgctattaatgcctacagcggcggtacctttgcaccaggtcggtgttctaactatgaaggaaactgcacttccggtaactctgcgactgaaccctacattgtggcacaccatttgcttcttgctcattcagctgctgtcaaaatatacaaggacaaatatcaggcttcccaaaagggacagatcgggattaccatagtcactcactggtggaaacctaagttcccagaacagctggctagccggaaagccacccttagatcacttgcctttatgtttggatggtttatggatcctatatttcatggtgattatccgaaggtcatgcgatctttggtcgggaatagattgccgaaatttacagaagctgaatcgaagcagataaaagggtccctcgattttcttgggtataattattacacaacatattatacagtagatgaaccggcttcatccaactttgtcaaccatagttggagtgcagacagacaaatcgctgcttctactactgatagaaatggggctcttattggtgcagcaactgatctggattggcttttcgtttatccgaaggggatcagagaggttcttgtgtatataaaggaaaagtacaataaccccgacatttacataactgagaatggatatgcgtatggatataatgcctcaatgccaattcaagaagctcgtaaggataatttgagaataagataccatcacgaccatctgtggtatcttttgaaagctattaaggatggggttaaagtgaagggatactatgcgtggtcattttgggatgacttcgaatgggatgctggttacacagttgggtttggcctaacattagttgatgtcaaggataatctgagaagatacctcaaatattctgcctattggttcaagatgttcctcctgcactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004553 GO:0008150 GO:0008152 GO:0008422 GO:0015926 GO:0016787 GO:0016798 GO:0071704 GO:1901135 GO:1901657

KEGG Pathways

Metabolic & Signaling

ko00460 ko00500 ko00940 ko01100 ko01110 map00460 map00500 map00940 map01100 map01110

Pfam Domains

Protein Families

Glyco_hydro_1

Protein Analysis

596

Amino Acids

66.91

Weight (kDa)

8.43

Isoelectric Point (pI)

25.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003709)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G44480 AT2G44480 AT2G44480 AT2G44480 AT2G44480
fragaria_vesca	FvH4_7g00214 FvH4_7g00214 FvH4_7g00214 FvH4_7g00214 FvH4_7g00250 FvH4_7g00270
malus_domestica	MD07G1003400.v1.1
prunus_persica	Prupe.2G005100_v2.0.a1
pyrus_communis	pycom07g00340
rosa_chinensis	RchiOBHm_Chr1g0313661 RchiOBHm_Chr1g0313711 RchiOBHm_Chr1g0313741
rosa_laevigata	RLG00000030780 RLG00000030783 RLG00000030785
rosa_multiflora	Rmu_sc0009740.1_g000006 Rmu_ssc0000027.1_g000024
rosa_roxburghii	Rroxscaffold_4G00332110 Rroxscaffold_4G00332130
rosa_rugosa	RorugPtG0005800 RorugPtG0005900.1 RorugPtG0006000.1
rosa_samantha	Rh1AG005800 Rh1CG008900 Rh1CG009000 Rh1DG004000 Rh1DG004200
rosa_wichuraiana	Rw1G000340 Rw1G000350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	459
Acc65I	GGTACC	1 cut(s)	896
AccB1I	GGYRCC	2 cut(s)	311, 896
AciI	CCGC	3 cut(s)	759, 891, 894
AclWI	GGATC	5 cut(s)	423, 722, 1157, 1170, 1454
AcsI	RAATTY	3 cut(s)	578, 656, 1226
AcuI	CTGAAG	1 cut(s)	357
AdeI	CACNNNGTG	2 cut(s)	572, 650
AfaI	GTAC	2 cut(s)	898, 1481
AfiI	CCNNNNNNNGG	3 cut(s)	43, 220, 460
AflII	CTTAAG	1 cut(s)	766
AgsI	TTSAA	6 cut(s)	100, 172, 817, 1550, 1612, 1771
AjnI	CCWGG	1 cut(s)	907
AjuI	GAANNNNNNNTTGG	2 cut(s)	476, 508
Alw21I	GWGCWC	2 cut(s)	606, 684
Alw26I	GTCTC	1 cut(s)	423
AlwI	GGATC	5 cut(s)	423, 722, 1157, 1170, 1454
AlwNI	CAGNNNCTG	3 cut(s)	1007, 1238, 1412
AoxI	GGCC	2 cut(s)	521, 1705
ApoI	RAATTY	3 cut(s)	578, 656, 1226
AseI	ATTAAT	1 cut(s)	879
Asp718I	GGTACC	1 cut(s)	896
AspS9I	GGNCC	3 cut(s)	365, 522, 1260
AsuHPI	GGTGA	4 cut(s)	443, 721, 839, 1190
AsuII	TTCGAA	1 cut(s)	1674
AsuNHI	GCTAGC	1 cut(s)	1109
AvaII	GGWCC	2 cut(s)	365, 1260
BaeI	ACNNNNGTAYC	2 cut(s)	372, 405
BamHI	GGATCC	1 cut(s)	1162
BanI	GGYRCC	2 cut(s)	311, 896
BanII	GRGCYC	3 cut(s)	606, 684, 1396
Bbv12I	GWGCWC	2 cut(s)	606, 684
BccI	CCATC	5 cut(s)	350, 1146, 1593, 1602, 1619
BcgI	CGANNNNNNTGC	4 cut(s)	1177, 1211, 1664, 1698
BciT130I	CCWGG	1 cut(s)	909
BciVI	GTATCC	4 cut(s)	373, 619, 697, 1637
BcoDI	GTCTC	1 cut(s)	423
BfaI	CTAG	3 cut(s)	353, 369, 1110
BfmI	CTRYAG	3 cut(s)	48, 225, 886
BfrI	CTTAAG	1 cut(s)	766
BfuI	GTATCC	4 cut(s)	373, 619, 697, 1637
Bme1390I	CCNGG	1 cut(s)	909
Bme18I	GGWCC	2 cut(s)	365, 1260
BmgT120I	GGNCC	3 cut(s)	365, 522, 1260
BmiI	GGNNCC	6 cut(s)	313, 366, 898, 1164, 1261, 1262
BmrFI	CCNGG	1 cut(s)	909
BmrI	ACTGGG	1 cut(s)	853
BmsI	GCATC	4 cut(s)	70, 247, 381, 1672
BmtI	GCTAGC	1 cut(s)	1113
BmuI	ACTGGG	1 cut(s)	853
Bpu14I	TTCGAA	1 cut(s)	1674
BsaJI	CCNNGG	2 cut(s)	537, 705
BsaWI	WCCGGW	1 cut(s)	944
BsaXI	ACNNNNNCTCC	5 cut(s)	33, 180, 210, 786, 816
Bsc4I	CCNNNNNNNGG	3 cut(s)	43, 220, 460
Bse118I	RCCGGY	2 cut(s)	314, 1315
Bse1I	ACTGG	3 cut(s)	301, 848, 1082
BseBI	CCWGG	1 cut(s)	909
BseDI	CCNNGG	2 cut(s)	537, 705
BseGI	GGATG	6 cut(s)	397, 1157, 1322, 1630, 1672, 1687
BseLI	CCNNNNNNNGG	3 cut(s)	43, 220, 460
BseMII	CTCAG	2 cut(s)	1497, 1727
BseNI	ACTGG	3 cut(s)	301, 848, 1082
BseRI	GAGGAG	2 cut(s)	570, 648
BsgI	GTGCAG	4 cut(s)	922, 1371, 1425, 1769
BshFI	GGCC	2 cut(s)	523, 1707
BshNI	GGYRCC	2 cut(s)	311, 896
BsiHKAI	GWGCWC	2 cut(s)	606, 684
BsiSI	CCGG	4 cut(s)	315, 945, 1114, 1316
BslFI	GGGAC	3 cut(s)	378, 1062, 1246
BslI	CCNNNNNNNGG	3 cut(s)	43, 220, 460
BsmAI	GTCTC	1 cut(s)	423
BsmBI	CGTCTC	1 cut(s)	423
BsmFI	GGGAC	3 cut(s)	378, 1062, 1246
BsnI	GGCC	2 cut(s)	523, 1707
Bsp119I	TTCGAA	1 cut(s)	1674
Bsp1286I	GDGCHC	3 cut(s)	606, 684, 1396
BspACI	CCGC	3 cut(s)	759, 891, 894
BspANI	GGCC	2 cut(s)	523, 1707
BspCNI	CTCAG	2 cut(s)	1498, 1728
BspLI	GGNNCC	6 cut(s)	313, 366, 898, 1164, 1261, 1262
BspMAI	CTGCAG	2 cut(s)	52, 229
BspOI	GCTAGC	1 cut(s)	1113
BspPI	GGATC	5 cut(s)	423, 722, 1157, 1170, 1454
BspT104I	TTCGAA	1 cut(s)	1674
BspT107I	GGYRCC	2 cut(s)	311, 896
BspTI	CTTAAG	1 cut(s)	766
BsrFI	RCCGGY	2 cut(s)	314, 1315
BsrI	ACTGG	3 cut(s)	301, 848, 1082
BssAI	RCCGGY	2 cut(s)	314, 1315
BssECI	CCNNGG	2 cut(s)	537, 705
BssT1I	CCWWGG	2 cut(s)	537, 705
Bst2UI	CCWGG	1 cut(s)	909
Bst4CI	ACNGT	2 cut(s)	1306, 1696
BstAFI	CTTAAG	1 cut(s)	766
BstBI	TTCGAA	1 cut(s)	1674
BstC8I	GCNNGC	4 cut(s)	58, 235, 1107, 1111
BstDEI	CTNAG	6 cut(s)	548, 626, 1089, 1127, 1506, 1736
BstF5I	GGATG	6 cut(s)	397, 1157, 1322, 1630, 1672, 1687
BstMAI	GTCTC	1 cut(s)	423
BstMWI	GCNNNNNNNGC	6 cut(s)	53, 143, 230, 320, 881, 1001
BstNI	CCWGG	1 cut(s)	909
BstSCI	CCNGG	1 cut(s)	907
BstSFI	CTRYAG	3 cut(s)	48, 225, 886
BstX2I	RGATCY	1 cut(s)	1162
BstYI	RGATCY	1 cut(s)	1162
BsuI	GTATCC	4 cut(s)	373, 619, 697, 1637
BsuRI	GGCC	2 cut(s)	523, 1707
BtsCI	GGATG	6 cut(s)	397, 1157, 1322, 1630, 1672, 1687
BtsIMutI	CAGTG	4 cut(s)	294, 841, 1075, 1786
Cac8I	GCNNGC	4 cut(s)	58, 235, 1107, 1111
CaiI	CAGNNNCTG	3 cut(s)	1007, 1238, 1412
Cfr10I	RCCGGY	2 cut(s)	314, 1315
Cfr13I	GGNCC	3 cut(s)	365, 522, 1260
CsiI	ACCWGGT	1 cut(s)	907
Csp6I	GTAC	2 cut(s)	897, 1480
CviAII	CATG	3 cut(s)	519, 1175, 1195
CviQI	GTAC	2 cut(s)	897, 1480
DdeI	CTNAG	6 cut(s)	548, 626, 1089, 1127, 1506, 1736
DraIII	CACNNNGTG	2 cut(s)	572, 650
Ecl136II	GAGCTC	2 cut(s)	604, 682
Eco130I	CCWWGG	2 cut(s)	537, 705
Eco24I	GRGCYC	3 cut(s)	606, 684, 1396
Eco47I	GGWCC	2 cut(s)	365, 1260
Eco53kI	GAGCTC	2 cut(s)	604, 682
Eco57I	CTGAAG	1 cut(s)	357
EcoICRI	GAGCTC	2 cut(s)	604, 682
EcoO109I	RGGNCCY	2 cut(s)	365, 1260
EcoRII	CCWGG	1 cut(s)	907
EcoT14I	CCWWGG	2 cut(s)	537, 705
EcoT38I	GRGCYC	3 cut(s)	606, 684, 1396
ErhI	CCWWGG	2 cut(s)	537, 705
Esp3I	CGTCTC	1 cut(s)	423
FaeI	CATG	3 cut(s)	522, 1178, 1198
FalI	AAGNNNNNCTT	2 cut(s)	1110, 1142
FaqI	GGGAC	3 cut(s)	378, 1062, 1246
FatI	CATG	3 cut(s)	518, 1174, 1194
FauI	CCCGC	1 cut(s)	752
FokI	GGATG	6 cut(s)	384, 1164, 1309, 1637, 1679, 1694
FriOI	GRGCYC	3 cut(s)	606, 684, 1396
FspBI	CTAG	3 cut(s)	353, 369, 1110
HaeIII	GGCC	2 cut(s)	523, 1707
HapII	CCGG	4 cut(s)	315, 945, 1114, 1316
Hin1II	CATG	3 cut(s)	522, 1178, 1198
HincII	GTYRAC	1 cut(s)	1336
HindII	GTYRAC	1 cut(s)	1336
HinfI	GANTC	5 cut(s)	123, 300, 497, 507, 1241
HpaII	CCGG	4 cut(s)	315, 945, 1114, 1316
HphI	GGTGA	4 cut(s)	443, 721, 839, 1190
Hpy166II	GTNNAC	3 cut(s)	562, 640, 1336
Hpy188I	TCNGA	8 cut(s)	79, 256, 337, 506, 1188, 1440, 1451, 1737
Hpy188III	TCNNGA	9 cut(s)	353, 401, 817, 1057, 1210, 1418, 1550, 1589, 1771
Hpy8I	GTNNAC	3 cut(s)	562, 640, 1336
HpyAV	CCTTC	6 cut(s)	332, 354, 923, 1183, 1435, 1633
HpyCH4III	ACNGT	2 cut(s)	1306, 1696
HpyCH4IV	ACGT	1 cut(s)	432
HpyCH4V	TGCA	7 cut(s)	50, 227, 905, 939, 1352, 1406, 1786
HpyF10VI	GCNNNNNNNGC	6 cut(s)	53, 143, 230, 320, 881, 1001
HpyF3I	CTNAG	6 cut(s)	548, 626, 1089, 1127, 1506, 1736
HpySE526I	ACGT	1 cut(s)	432
Hsp92II	CATG	3 cut(s)	522, 1178, 1198
KflI	GGGWCCC	1 cut(s)	1260
KpnI	GGTACC	1 cut(s)	900
LmnI	GCTCC	4 cut(s)	39, 216, 341, 723
LweI	GCATC	4 cut(s)	70, 247, 381, 1672
MabI	ACCWGGT	1 cut(s)	907
MaeI	CTAG	3 cut(s)	353, 369, 1110
MaeII	ACGT	1 cut(s)	432
MaeIII	GTNAC	5 cut(s)	709, 847, 947, 1069, 1688
MboII	GAAGA	2 cut(s)	493, 1752
MflI	RGATCY	1 cut(s)	1162
MhlI	GDGCHC	3 cut(s)	606, 684, 1396
MluCI	AATT	8 cut(s)	486, 513, 578, 656, 1226, 1282, 1545, 1567
MlyI	GAGTC	1 cut(s)	491
MmeI	TCCRAC	3 cut(s)	474, 1325, 1350
MseI	TTAA	5 cut(s)	276, 767, 879, 1620, 1632
MspA1I	CMGCKG	7 cut(s)	53, 146, 230, 323, 891, 1004, 1105
MspCI	CTTAAG	1 cut(s)	766
MspI	CCGG	4 cut(s)	315, 945, 1114, 1316
MspR9I	CCNGG	1 cut(s)	909
MvaI	CCWGG	1 cut(s)	909
MwoI	GCNNNNNNNGC	6 cut(s)	53, 143, 230, 320, 881, 1001
NheI	GCTAGC	1 cut(s)	1109
NlaIII	CATG	3 cut(s)	522, 1178, 1198
NlaIV	GGNNCC	6 cut(s)	313, 366, 898, 1164, 1261, 1262
NmuCI	GTSAC	3 cut(s)	709, 847, 1069
NspV	TTCGAA	1 cut(s)	1674
PfeI	GAWTC	4 cut(s)	123, 300, 507, 1241
PleI	GAGTC	1 cut(s)	491
PpsI	GAGTC	1 cut(s)	491
PpuMI	RGGWCCY	2 cut(s)	365, 1260
PshBI	ATTAAT	1 cut(s)	879
PsiI	TTATAA	1 cut(s)	459
Psp124BI	GAGCTC	2 cut(s)	606, 684
Psp5II	RGGWCCY	2 cut(s)	365, 1260
Psp6I	CCWGG	1 cut(s)	907
PspGI	CCWGG	1 cut(s)	907
PspN4I	GGNNCC	6 cut(s)	313, 366, 898, 1164, 1261, 1262
PspPI	GGNCC	3 cut(s)	365, 522, 1260
PspPPI	RGGWCCY	2 cut(s)	365, 1260
PsrI	GAACNNNNNNTAC	2 cut(s)	746, 778
PstI	CTGCAG	2 cut(s)	52, 229
PstNI	CAGNNNCTG	3 cut(s)	1007, 1238, 1412
PsuI	RGATCY	1 cut(s)	1162
PvuII	CAGCTG	6 cut(s)	53, 146, 230, 323, 1004, 1105
RsaI	GTAC	2 cut(s)	898, 1481
RsaNI	GTAC	2 cut(s)	897, 1480
SacI	GAGCTC	2 cut(s)	606, 684
SaqAI	TTAA	5 cut(s)	276, 767, 879, 1620, 1632
Sau96I	GGNCC	3 cut(s)	365, 522, 1260
SchI	GAGTC	1 cut(s)	491
ScrFI	CCNGG	1 cut(s)	909
SduI	GDGCHC	3 cut(s)	606, 684, 1396
SexAI	ACCWGGT	1 cut(s)	907
SfaNI	GCATC	4 cut(s)	70, 247, 381, 1672
SfcI	CTRYAG	3 cut(s)	48, 225, 886
SfuI	TTCGAA	1 cut(s)	1674
SinI	GGWCC	2 cut(s)	365, 1260
SmlI	CTYRAG	1 cut(s)	766
SmoI	CTYRAG	1 cut(s)	766
Sse9I	AATT	8 cut(s)	486, 513, 578, 656, 1226, 1282, 1545, 1567
SsiI	CCGC	3 cut(s)	759, 891, 894
SspI	AATATT	1 cut(s)	1754
SspMI	CTAG	3 cut(s)	353, 369, 1110
SstI	GAGCTC	2 cut(s)	606, 684
StyD4I	CCNGG	1 cut(s)	907
StyI	CCWWGG	2 cut(s)	537, 705
TaaI	ACNGT	2 cut(s)	1306, 1696
TaiI	ACGT	1 cut(s)	435
TaqI	TCGA	4 cut(s)	832, 1244, 1266, 1674
TasI	AATT	8 cut(s)	486, 513, 578, 656, 1226, 1282, 1545, 1567
TatI	WGTACW	1 cut(s)	1479
TauI	GCSGC	1 cut(s)	894
TfiI	GAWTC	4 cut(s)	123, 300, 507, 1241
Tru1I	TTAA	5 cut(s)	276, 767, 879, 1620, 1632
Tru9I	TTAA	5 cut(s)	276, 767, 879, 1620, 1632
TscAI	CASTG	3 cut(s)	301, 848, 1082
TseFI	GTSAC	3 cut(s)	709, 847, 1069
Tsp45I	GTSAC	3 cut(s)	709, 847, 1069
TspDTI	ATGAA	7 cut(s)	494, 507, 869, 942, 1163, 1311, 1326
TspGWI	ACGGA	3 cut(s)	55, 232, 882
TspRI	CASTG	3 cut(s)	301, 848, 1082
Vha464I	CTTAAG	1 cut(s)	766
VpaK11BI	GGWCC	2 cut(s)	365, 1260
VspI	ATTAAT	1 cut(s)	879
XapI	RAATTY	3 cut(s)	578, 656, 1226
XbaI	TCTAGA	1 cut(s)	352
XcmI	CCANNNNNNNNNTGG	1 cut(s)	408
XspI	CTAG	3 cut(s)	353, 369, 1110

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.