Rmu_ssc0000050.1_g000113

Peptidyl-prolyl cis-trans isomerase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000050.1
Physical Location & Seq
Forward (+)
517453 .. 520184
2732 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000050.1_g000113.1.cds

Sequence Viewer

Length: 1095 bp
atgggggagaggccacggtgctttctggacattagcataggaggagagcttgaaggacggatagtgatcgagctttacgaccatgtagtgcccaaaacggcagagaatttcagagctctctgtactggtgagaaaggcattggtcccaatactggtgtccccctccactacaagggaaaccattttcatcgtgttatcaaaggctttatgatacaagggggtgatatttctgctggagatggcacggggggagagtctatctatgggctgaaatttgaagacgaaaattttgaattgaaacatgaaaggaaaggcatgttatccatggccaatgctggtccgaacaccaatgggtctcagttttttatcacaacaactcgcactgctcatttagatgggaaacatgtggtgtttgggaaggtagtgaaaggcatgggagtggttcgttcaatagagcacatttccactggtgagggcggtgattctccgactgttgatgttgttattgcggattgtggagaaattcctgagggggctgatgatggaatatctaatttattcaaagatggtgacacttaccctgattggccagctgacctagataacagtcctgatgagctttcttggtggatgacttctgtagattcaatcaaggcttttggtaatgaatatttcaagaaacaagactacaagatggctctcagaaagtatcggaaatctttgcgctatctcgatatttgttgggagaaagatggaattgatgaagagaagagttcaagtttgagaaaaaccaagtcacagattttcactaacagctctgcttgtaaattgaaattgggggacctgaaaggagcactgttagacactgactttgcaatgagggatggagaaaataatgttaaggctttgtttcgacaaggtcaggcatacatagcacttaatgatattgatgctgcagttgagagcttcaaaaaggcattggatttggagcccactgatgctggaataaaaaaggagcttgctgctgctaagaagaagatttctagtaggcgtgatcaggagaagaaggcctacagcaagatgtttcagaaatag

Protein Analysis

364

Amino Acids

40.27

Weight (kDa)

6.12

Isoelectric Point (pI)

24.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 477, 509
AcoI YGGCCR 2 cut(s) 327, 587
AcsI RAATTY 4 cut(s) 106, 272, 286, 522
AfaI GTAC 1 cut(s) 124
AfiI CCNNNNNNNGG 2 cut(s) 152, 172
AflIII ACRYGT 1 cut(s) 403
AluBI AGCT 8 cut(s) 49, 73, 116, 593, 619, 816, 966, 1018
AluI AGCT 8 cut(s) 49, 73, 116, 593, 619, 816, 966, 1018
Alw21I GWGCWC 3 cut(s) 118, 459, 856
Alw26I GTCTC 1 cut(s) 360
AoxI GGCC 4 cut(s) 11, 327, 587, 1068
ApeKI GCWGC 3 cut(s) 953, 1022, 1025
ApoI RAATTY 4 cut(s) 106, 272, 286, 522
ArsI GACNNNNNNTTYG 4 cut(s) 272, 304, 854, 886
AspLEI GCGC 1 cut(s) 726
AspS9I GGNCC 3 cut(s) 143, 338, 841
AsuHPI GGTGA 5 cut(s) 140, 233, 482, 491, 581
AvaII GGWCC 3 cut(s) 143, 338, 841
AxyI CCTNAGG 1 cut(s) 528
BaeGI GKGCMC 1 cut(s) 93
BalI TGGCCA 2 cut(s) 329, 589
BanII GRGCYC 2 cut(s) 118, 993
BarI GAAGNNNNNNTAC 2 cut(s) 1055, 1087
BbsI GAAGAC 1 cut(s) 285
Bbv12I GWGCWC 3 cut(s) 118, 459, 856
BbvI GCAGC 3 cut(s) 940, 1009, 1012
BccI CCATC 7 cut(s) 233, 389, 536, 560, 688, 746, 878
BceAI ACGGC 1 cut(s) 114
BclI TGATCA 1 cut(s) 1054
BcoDI GTCTC 1 cut(s) 360
BfaI CTAG 2 cut(s) 599, 1044
BfmI CTRYAG 3 cut(s) 639, 954, 1072
BisI GCNGC 3 cut(s) 954, 1023, 1026
BlsI GCNGC 3 cut(s) 955, 1024, 1027
Bme18I GGWCC 3 cut(s) 143, 338, 841
BmgT120I GGNCC 3 cut(s) 143, 338, 841
BmiI GGNNCC 3 cut(s) 145, 842, 990
BmsI GCATC 2 cut(s) 940, 988
BpiI GAAGAC 1 cut(s) 285
BpmI CTGGAG 1 cut(s) 255
BsaBI GATNNNNATC 1 cut(s) 65
BsaI GGTCTC 1 cut(s) 360
BsaJI CCNNGG 2 cut(s) 14, 324
Bsc4I CCNNNNNNNGG 2 cut(s) 152, 172
Bse1I ACTGG 3 cut(s) 130, 157, 472
Bse21I CCTNAGG 1 cut(s) 528
Bse3DI GCAATG 1 cut(s) 882
Bse8I GATNNNNATC 1 cut(s) 65
BseDI CCNNGG 2 cut(s) 14, 324
BseGI GGATG 2 cut(s) 636, 889
BseJI GATNNNNATC 1 cut(s) 65
BseLI CCNNNNNNNGG 2 cut(s) 152, 172
BseMI GCAATG 1 cut(s) 882
BseMII CTCAG 3 cut(s) 371, 519, 715
BseNI ACTGG 3 cut(s) 130, 157, 472
BseRI GAGGAG 1 cut(s) 57
BseSI GKGCMC 1 cut(s) 93
BseXI GCAGC 3 cut(s) 940, 1009, 1012
BshFI GGCC 4 cut(s) 13, 329, 589, 1070
BsiHKAI GWGCWC 3 cut(s) 118, 459, 856
BslFI GGGAC 3 cut(s) 129, 143, 854
BslI CCNNNNNNNGG 2 cut(s) 152, 172
BsmAI GTCTC 1 cut(s) 360
BsmFI GGGAC 3 cut(s) 129, 143, 854
BsnI GGCC 4 cut(s) 13, 329, 589, 1070
Bso31I GGTCTC 1 cut(s) 360
Bsp1286I GDGCHC 5 cut(s) 93, 118, 459, 856, 993
Bsp143I GATC 2 cut(s) 66, 1054
Bsp19I CCATGG 1 cut(s) 324
BspACI CCGC 2 cut(s) 477, 509
BspANI GGCC 4 cut(s) 13, 329, 589, 1070
BspCNI CTCAG 3 cut(s) 370, 520, 714
BspLI GGNNCC 3 cut(s) 145, 842, 990
BspMAI CTGCAG 1 cut(s) 958
BspTNI GGTCTC 1 cut(s) 360
BsrDI GCAATG 1 cut(s) 882
BsrI ACTGG 3 cut(s) 130, 157, 472
BssECI CCNNGG 2 cut(s) 14, 324
BssMI GATC 2 cut(s) 66, 1054
BssT1I CCWWGG 1 cut(s) 324
Bst4CI ACNGT 4 cut(s) 18, 493, 608, 858
Bst6I CTCTTC 2 cut(s) 759, 764
BstC8I GCNNGC 2 cut(s) 591, 1020
BstDEI CTNAG 4 cut(s) 357, 528, 701, 1029
BstDSI CCRYGG 2 cut(s) 14, 324
BstF5I GGATG 2 cut(s) 636, 889
BstHHI GCGC 1 cut(s) 726
BstKTI GATC 2 cut(s) 69, 1057
BstMAI GTCTC 1 cut(s) 360
BstMBI GATC 2 cut(s) 66, 1054
BstMWI GCNNNNNNNGC 1 cut(s) 932
BstNSI RCATGY 2 cut(s) 319, 407
BstSFI CTRYAG 3 cut(s) 639, 954, 1072
BstSLI GKGCMC 1 cut(s) 93
BstV1I GCAGC 3 cut(s) 940, 1009, 1012
BstV2I GAAGAC 1 cut(s) 285
Bsu36I CCTNAGG 1 cut(s) 528
BsuRI GGCC 4 cut(s) 13, 329, 589, 1070
BtgI CCRYGG 2 cut(s) 14, 324
BtsCI GGATG 2 cut(s) 636, 889
BtsI GCAGTG 1 cut(s) 381
BtsIMutI CAGTG 5 cut(s) 381, 465, 854, 864, 993
Cac8I GCNNGC 2 cut(s) 591, 1020
CfoI GCGC 1 cut(s) 726
Cfr13I GGNCC 3 cut(s) 143, 338, 841
Csp6I GTAC 1 cut(s) 123
CviAII CATG 6 cut(s) 83, 302, 316, 325, 404, 433
CviQI GTAC 1 cut(s) 123
DdeI CTNAG 4 cut(s) 357, 528, 701, 1029
DpnI GATC 2 cut(s) 68, 1056
DpnII GATC 2 cut(s) 66, 1054
EaeI YGGCCR 2 cut(s) 327, 587
Eam1104I CTCTTC 2 cut(s) 759, 764
EarI CTCTTC 2 cut(s) 759, 764
Ecl136II GAGCTC 1 cut(s) 116
Eco130I CCWWGG 1 cut(s) 324
Eco147I AGGCCT 1 cut(s) 1070
Eco24I GRGCYC 2 cut(s) 118, 993
Eco31I GGTCTC 1 cut(s) 360
Eco47I GGWCC 3 cut(s) 143, 338, 841
Eco53kI GAGCTC 1 cut(s) 116
Eco81I CCTNAGG 1 cut(s) 528
EcoICRI GAGCTC 1 cut(s) 116
EcoO109I RGGNCCY 1 cut(s) 841
EcoT14I CCWWGG 1 cut(s) 324
EcoT38I GRGCYC 2 cut(s) 118, 993
ErhI CCWWGG 1 cut(s) 324
FaeI CATG 6 cut(s) 86, 305, 319, 328, 407, 436
FaqI GGGAC 3 cut(s) 129, 143, 854
FatI CATG 6 cut(s) 82, 301, 315, 324, 403, 432
FbaI TGATCA 1 cut(s) 1054
Fnu4HI GCNGC 3 cut(s) 954, 1023, 1026
FokI GGATG 2 cut(s) 643, 896
FriOI GRGCYC 2 cut(s) 118, 993
Fsp4HI GCNGC 3 cut(s) 954, 1023, 1026
FspBI CTAG 2 cut(s) 599, 1044
GlaI GCGC 1 cut(s) 725
GluI GCNGC 3 cut(s) 954, 1023, 1026
GsuI CTGGAG 1 cut(s) 255
HaeIII GGCC 4 cut(s) 13, 329, 589, 1070
HhaI GCGC 1 cut(s) 726
Hin1II CATG 6 cut(s) 86, 305, 319, 328, 407, 436
Hin6I GCGC 1 cut(s) 724
HinP1I GCGC 1 cut(s) 724
HinfI GANTC 3 cut(s) 254, 482, 644
HphI GGTGA 5 cut(s) 140, 233, 482, 491, 581
Hpy188I TCNGA 6 cut(s) 113, 342, 489, 704, 714, 1089
Hpy188III TCNNGA 6 cut(s) 26, 527, 611, 676, 731, 1058
HpyAV CCTTC 3 cut(s) 47, 412, 1060
HpyCH4III ACNGT 4 cut(s) 18, 493, 608, 858
HpyCH4V TGCA 2 cut(s) 875, 956
HpyF10VI GCNNNNNNNGC 1 cut(s) 932
HpyF3I CTNAG 4 cut(s) 357, 528, 701, 1029
Hsp92II CATG 6 cut(s) 86, 305, 319, 328, 407, 436
HspAI GCGC 1 cut(s) 724
Ksp22I TGATCA 1 cut(s) 1054
Kzo9I GATC 2 cut(s) 66, 1054
LmnI GCTCC 3 cut(s) 851, 988, 1015
Lsp1109I GCAGC 3 cut(s) 940, 1009, 1012
LweI GCATC 2 cut(s) 940, 988
MaeI CTAG 2 cut(s) 599, 1044
MaeIII GTNAC 2 cut(s) 569, 795
MalI GATC 2 cut(s) 68, 1056
MboI GATC 2 cut(s) 66, 1054
MboII GAAGA 6 cut(s) 290, 776, 781, 1045, 1048, 1075
MhlI GDGCHC 5 cut(s) 93, 118, 459, 856, 993
MlsI TGGCCA 2 cut(s) 329, 589
MluCI AATT 9 cut(s) 106, 272, 286, 293, 522, 553, 756, 827, 833
MluNI TGGCCA 2 cut(s) 329, 589
MlyI GAGTC 1 cut(s) 263
MmeI TCCRAC 1 cut(s) 512
MnlI CCTC 6 cut(s) 3, 35, 173, 466, 523, 873
Mox20I TGGCCA 2 cut(s) 329, 589
MscI TGGCCA 2 cut(s) 329, 589
MseI TTAA 2 cut(s) 900, 939
MslI CAYNNNNRTG 2 cut(s) 393, 437
Msp20I TGGCCA 2 cut(s) 329, 589
MspA1I CMGCKG 1 cut(s) 593
MwoI GCNNNNNNNGC 1 cut(s) 932
NcoI CCATGG 1 cut(s) 324
NdeII GATC 2 cut(s) 66, 1054
NlaIII CATG 6 cut(s) 86, 305, 319, 328, 407, 436
NlaIV GGNNCC 3 cut(s) 145, 842, 990
NmuCI GTSAC 2 cut(s) 569, 795
NspI RCATGY 2 cut(s) 319, 407
PceI AGGCCT 1 cut(s) 1070
PciI ACATGT 1 cut(s) 403
PcsI WCGNNNNNNNCGW 1 cut(s) 75
PfeI GAWTC 2 cut(s) 482, 644
PflFI GACNNNGTC 1 cut(s) 918
PkrI GCNGC 3 cut(s) 955, 1024, 1027
PleI GAGTC 1 cut(s) 262
PpsI GAGTC 1 cut(s) 262
PpuMI RGGWCCY 1 cut(s) 841
PscI ACATGT 1 cut(s) 403
Psp124BI GAGCTC 1 cut(s) 118
Psp5II RGGWCCY 1 cut(s) 841
PspN4I GGNNCC 3 cut(s) 145, 842, 990
PspPI GGNCC 3 cut(s) 143, 338, 841
PspPPI RGGWCCY 1 cut(s) 841
PstI CTGCAG 1 cut(s) 958
PsyI GACNNNGTC 1 cut(s) 918
PvuII CAGCTG 1 cut(s) 593
RsaI GTAC 1 cut(s) 124
RsaNI GTAC 1 cut(s) 123
RseI CAYNNNNRTG 2 cut(s) 393, 437
SacI GAGCTC 1 cut(s) 118
SaqAI TTAA 2 cut(s) 900, 939
SatI GCNGC 3 cut(s) 954, 1023, 1026
Sau3AI GATC 2 cut(s) 66, 1054
Sau96I GGNCC 3 cut(s) 143, 338, 841
SchI GAGTC 1 cut(s) 263
SduI GDGCHC 5 cut(s) 93, 118, 459, 856, 993
SfaNI GCATC 2 cut(s) 940, 988
SfcI CTRYAG 3 cut(s) 639, 954, 1072
SinI GGWCC 3 cut(s) 143, 338, 841
SmiMI CAYNNNNRTG 2 cut(s) 393, 437
Sse9I AATT 9 cut(s) 106, 272, 286, 293, 522, 553, 756, 827, 833
SseBI AGGCCT 1 cut(s) 1070
SsiI CCGC 2 cut(s) 477, 509
SspI AATATT 1 cut(s) 671
SspMI CTAG 2 cut(s) 599, 1044
SstI GAGCTC 1 cut(s) 118
StuI AGGCCT 1 cut(s) 1070
StyI CCWWGG 1 cut(s) 324
TaaI ACNGT 4 cut(s) 18, 493, 608, 858
TaqI TCGA 3 cut(s) 69, 732, 913
TasI AATT 9 cut(s) 106, 272, 286, 293, 522, 553, 756, 827, 833
TatI WGTACW 1 cut(s) 122
TfiI GAWTC 2 cut(s) 482, 644
Tru1I TTAA 2 cut(s) 900, 939
Tru9I TTAA 2 cut(s) 900, 939
TscAI CASTG 5 cut(s) 388, 472, 861, 871, 1000
TseFI GTSAC 2 cut(s) 569, 795
TseI GCWGC 3 cut(s) 953, 1022, 1025
Tsp45I GTSAC 2 cut(s) 569, 795
TspDTI ATGAA 4 cut(s) 176, 318, 681, 777
TspGWI ACGGA 1 cut(s) 73
TspRI CASTG 5 cut(s) 388, 472, 861, 871, 1000
Tth111I GACNNNGTC 1 cut(s) 918
VpaK11BI GGWCC 3 cut(s) 143, 338, 841
XapI RAATTY 4 cut(s) 106, 272, 286, 522
XceI RCATGY 2 cut(s) 319, 407
XspI CTAG 2 cut(s) 599, 1044
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.