Rmu_ssc0000189.1_g000034
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000189.1
Physical Location & Seq
Reverse (-)
231269 .. 231586
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000189.1_g000034.1.cds

Sequence Viewer

Length: 318 bp
atgactgctatatttggattggcagacttttttaccatcaagaagcagaagatgtcagacaatctcaatgagattcctctgcaagtattaagggatgcaacctcagatttcagcacagccaatctattaggacgaggtggattttcttctatgttcaaaggtattatggaagacagtagtatgagggctgtgaagaagatggaaacgaagcactatggtcggttggacgctaagacacttaaatccttcaactctgagatcagagttctcaattctgttagacatgcaaatttagttgcattaatcggctattattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.8

Weight (kDa)

9.69

Isoelectric Point (pI)

37.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 289
AgsI TTSAA 2 cut(s) 157, 250
ApoI RAATTY 1 cut(s) 289
AseI ATTAAT 1 cut(s) 302
BbsI GAAGAC 1 cut(s) 177
BccI CCATC 2 cut(s) 44, 193
BcgI CGANNNNNNTGC 2 cut(s) 200, 234
BmsI GCATC 1 cut(s) 85
BpiI GAAGAC 1 cut(s) 177
BseGI GGATG 1 cut(s) 100
BseMII CTCAG 2 cut(s) 117, 246
Bsp143I GATC 1 cut(s) 258
BspCNI CTCAG 2 cut(s) 116, 247
BssMI GATC 1 cut(s) 258
Bst4CI ACNGT 1 cut(s) 176
BstDEI CTNAG 3 cut(s) 103, 231, 255
BstF5I GGATG 1 cut(s) 100
BstKTI GATC 1 cut(s) 261
BstMBI GATC 1 cut(s) 258
BstNSI RCATGY 1 cut(s) 287
BstV2I GAAGAC 1 cut(s) 177
BtsCI GGATG 1 cut(s) 100
CseI GACGC 1 cut(s) 236
CviAII CATG 1 cut(s) 284
CviJI RGCY 3 cut(s) 119, 188, 309
CviKI_1 RGCY 3 cut(s) 119, 188, 309
DdeI CTNAG 3 cut(s) 103, 231, 255
DpnI GATC 1 cut(s) 260
DpnII GATC 1 cut(s) 258
FaeI CATG 1 cut(s) 287
FaiI YATR 6 cut(s) 11, 152, 167, 182, 216, 285
FatI CATG 1 cut(s) 283
FokI GGATG 1 cut(s) 107
HgaI GACGC 1 cut(s) 236
Hin1II CATG 1 cut(s) 287
HinfI GANTC 1 cut(s) 73
Hpy188I TCNGA 4 cut(s) 58, 106, 256, 263
Hpy188III TCNNGA 1 cut(s) 40
HpyAV CCTTC 1 cut(s) 256
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4V TGCA 4 cut(s) 82, 98, 287, 299
HpyF3I CTNAG 3 cut(s) 103, 231, 255
Hsp92II CATG 1 cut(s) 287
Kzo9I GATC 1 cut(s) 258
LweI GCATC 1 cut(s) 85
MalI GATC 1 cut(s) 260
MboI GATC 1 cut(s) 258
MboII GAAGA 5 cut(s) 61, 138, 182, 205, 208
MluCI AATT 2 cut(s) 271, 289
MmeI TCCRAC 1 cut(s) 204
MnlI CCTC 4 cut(s) 87, 112, 128, 177
MseI TTAA 3 cut(s) 89, 240, 302
NdeII GATC 1 cut(s) 258
NlaIII CATG 1 cut(s) 287
NspI RCATGY 1 cut(s) 287
PfeI GAWTC 1 cut(s) 73
PshBI ATTAAT 1 cut(s) 302
SaqAI TTAA 3 cut(s) 89, 240, 302
Sau3AI GATC 1 cut(s) 258
SetI ASST 3 cut(s) 104, 139, 163
SfaNI GCATC 1 cut(s) 85
SgeI CNNG 4 cut(s) 52, 95, 146, 296
Sse9I AATT 2 cut(s) 271, 289
TaaI ACNGT 1 cut(s) 176
TasI AATT 2 cut(s) 271, 289
TfiI GAWTC 1 cut(s) 73
Tru1I TTAA 3 cut(s) 89, 240, 302
Tru9I TTAA 3 cut(s) 89, 240, 302
VspI ATTAAT 1 cut(s) 302
XapI RAATTY 1 cut(s) 289
XceI RCATGY 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.