Rmu_ssc0000281.1_g000031
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000281.1
Physical Location & Seq
Reverse (-)
121589 .. 121813
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000281.1_g000031.1.cds

Sequence Viewer

Length: 225 bp
atgcctccatctctgctctttctcgccgtgttccttgtcgtcggggcttcggagacgatgcatctgtcatgcatgttgaggcttcgtgacggcctgaagcccaagcctagtggttggtcagccagtgaccattgcatgtgggatggagtggagtgtgactctaatcatagaattgtgtccatcaacatggcctctaaggctctgtccggctctctccttccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.01

Weight (kDa)

6.8

Isoelectric Point (pI)

62.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 116
Alw26I GTCTC 1 cut(s) 47
AoxI GGCC 2 cut(s) 91, 189
BccI CCATC 3 cut(s) 16, 137, 188
BceAI ACGGC 2 cut(s) 11, 106
BcoDI GTCTC 1 cut(s) 47
BfaI CTAG 1 cut(s) 108
BglI GCCNNNNNGGC 1 cut(s) 197
BmsI GCATC 2 cut(s) 48, 70
BplI GAGNNNNNCTC 2 cut(s) 143, 175
Bse1I ACTGG 1 cut(s) 123
Bse3DI GCAATG 1 cut(s) 130
BseGI GGATG 1 cut(s) 148
BseMI GCAATG 1 cut(s) 130
BseNI ACTGG 1 cut(s) 123
BshFI GGCC 2 cut(s) 93, 191
BsiSI CCGG 1 cut(s) 207
BsmAI GTCTC 1 cut(s) 47
BsmBI CGTCTC 1 cut(s) 47
BsnI GGCC 2 cut(s) 93, 191
BspANI GGCC 2 cut(s) 93, 191
BsrDI GCAATG 1 cut(s) 130
BsrI ACTGG 1 cut(s) 123
BstDEI CTNAG 1 cut(s) 195
BstF5I GGATG 1 cut(s) 148
BstMAI GTCTC 1 cut(s) 47
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstNSI RCATGY 2 cut(s) 76, 139
BstXI CCANNNNNNTGG 1 cut(s) 187
BsuRI GGCC 2 cut(s) 93, 191
BtsCI GGATG 1 cut(s) 148
BtsIMutI CAGTG 1 cut(s) 130
CspCI CAANNNNNGTGG 2 cut(s) 91, 126
CviAII CATG 4 cut(s) 69, 73, 136, 187
CviJI RGCY 9 cut(s) 47, 82, 93, 100, 106, 122, 191, 200, 210
CviKI_1 RGCY 9 cut(s) 47, 82, 93, 100, 106, 122, 191, 200, 210
DdeI CTNAG 1 cut(s) 195
Eco57I CTGAAG 1 cut(s) 116
EcoT22I ATGCAT 2 cut(s) 63, 74
Esp3I CGTCTC 1 cut(s) 47
FaeI CATG 4 cut(s) 72, 76, 139, 190
FaiI YATR 6 cut(s) 70, 74, 137, 168, 188, 223
FatI CATG 4 cut(s) 68, 72, 135, 186
FokI GGATG 1 cut(s) 155
FspBI CTAG 1 cut(s) 108
HaeIII GGCC 2 cut(s) 93, 191
HapII CCGG 1 cut(s) 207
Hin1II CATG 4 cut(s) 72, 76, 139, 190
HinfI GANTC 1 cut(s) 158
HpaII CCGG 1 cut(s) 207
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 1 cut(s) 86
Hpy99I CGWCG 1 cut(s) 44
HpyCH4V TGCA 3 cut(s) 61, 72, 135
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 4 cut(s) 72, 76, 139, 190
LpnPI CCDG 3 cut(s) 107, 136, 220
LweI GCATC 2 cut(s) 48, 70
MaeI CTAG 1 cut(s) 108
MaeIII GTNAC 3 cut(s) 86, 125, 155
MluCI AATT 1 cut(s) 171
MlyI GAGTC 1 cut(s) 152
MnlI CCTC 3 cut(s) 15, 72, 202
Mph1103I ATGCAT 2 cut(s) 63, 74
MslI CAYNNNNRTG 1 cut(s) 185
MspI CCGG 1 cut(s) 207
MwoI GCNNNNNNNGC 1 cut(s) 197
NlaIII CATG 4 cut(s) 72, 76, 139, 190
NmuCI GTSAC 3 cut(s) 86, 125, 155
NsiI ATGCAT 2 cut(s) 63, 74
NspI RCATGY 2 cut(s) 76, 139
PleI GAGTC 1 cut(s) 152
PpsI GAGTC 1 cut(s) 152
RseI CAYNNNNRTG 1 cut(s) 185
SchI GAGTC 1 cut(s) 152
SfaNI GCATC 2 cut(s) 48, 70
SmiMI CAYNNNNRTG 1 cut(s) 185
Sse9I AATT 1 cut(s) 171
SspMI CTAG 1 cut(s) 108
TasI AATT 1 cut(s) 171
TscAI CASTG 1 cut(s) 130
TseFI GTSAC 3 cut(s) 86, 125, 155
Tsp45I GTSAC 3 cut(s) 86, 125, 155
TspRI CASTG 1 cut(s) 130
XceI RCATGY 2 cut(s) 76, 139
XspI CTAG 1 cut(s) 108
Zsp2I ATGCAT 2 cut(s) 63, 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.