Rh7CG353500
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
40420809 .. 40421273
465 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG353500.1

Sequence Viewer

Length: 300 bp
ATGGTAGTGTCCCTCAGATGGATAAAGCAACACTTGCCAAGGTTGTTGATGGGGAGATTGACTGTTTCTTACTTTTGTGTTGTGGCAGAGATTGCTATCCATTGCACCGAAAGGAAACCCGAGAGGAGGCCACACATGTCACATGCAGTGATGGAAATTTCAAAACTAATTGAGAAATCCTGGGAACTATCTAATCTAGTAGTTGATGACAATCCTTTCAATGCCAAGTCTTTTCTTACAACTGTACGTGAGTGGGAGGAGGAAGGTGAGTCTGATGAGGACGACATTAAGAAAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.62

Weight (kDa)

5.79

Isoelectric Point (pI)

53.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 156
AfaI GTAC 1 cut(s) 246
AfiI CCNNNNNNNGG 2 cut(s) 18, 126
AflIII ACRYGT 1 cut(s) 135
AgsI TTSAA 2 cut(s) 162, 220
AjnI CCWGG 1 cut(s) 179
Ama87I CYCGRG 1 cut(s) 119
AoxI GGCC 1 cut(s) 128
ApoI RAATTY 1 cut(s) 156
AsuHPI GGTGA 1 cut(s) 278
AvaI CYCGRG 1 cut(s) 119
BccI CCATC 3 cut(s) 12, 43, 145
BciT130I CCWGG 1 cut(s) 181
BfaI CTAG 1 cut(s) 197
Bme1390I CCNGG 1 cut(s) 181
BmeT110I CYCGRG 1 cut(s) 119
BmrFI CCNGG 1 cut(s) 181
BsaAI YACGTR 1 cut(s) 248
BsaBI GATNNNNATC 2 cut(s) 95, 210
BsaJI CCNNGG 2 cut(s) 38, 180
Bsc4I CCNNNNNNNGG 2 cut(s) 18, 126
Bse3DI GCAATG 1 cut(s) 100
Bse8I GATNNNNATC 2 cut(s) 95, 210
BseBI CCWGG 1 cut(s) 181
BseDI CCNNGG 2 cut(s) 38, 180
BseJI GATNNNNATC 2 cut(s) 95, 210
BseLI CCNNNNNNNGG 2 cut(s) 18, 126
BseMI GCAATG 1 cut(s) 100
BseMII CTCAG 1 cut(s) 28
BseRI GAGGAG 2 cut(s) 139, 272
BshFI GGCC 1 cut(s) 130
BsiHKCI CYCGRG 1 cut(s) 119
BslI CCNNNNNNNGG 2 cut(s) 18, 126
BsnI GGCC 1 cut(s) 130
BsoBI CYCGRG 1 cut(s) 119
BspANI GGCC 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 27
BsrDI GCAATG 1 cut(s) 100
BssECI CCNNGG 2 cut(s) 38, 180
BssT1I CCWWGG 1 cut(s) 38
Bst2UI CCWGG 1 cut(s) 181
Bst4CI ACNGT 2 cut(s) 64, 244
BstAPI GCANNNNNTGC 2 cut(s) 34, 92
BstBAI YACGTR 1 cut(s) 248
BstDEI CTNAG 1 cut(s) 14
BstMWI GCNNNNNNNGC 2 cut(s) 34, 92
BstNI CCWGG 1 cut(s) 181
BstNSI RCATGY 2 cut(s) 139, 146
BstSCI CCNGG 1 cut(s) 179
BsuRI GGCC 1 cut(s) 130
BtsI GCAGTG 1 cut(s) 153
BtsIMutI CAGTG 1 cut(s) 153
Csp6I GTAC 1 cut(s) 245
CviAII CATG 2 cut(s) 136, 143
CviJI RGCY 1 cut(s) 130
CviKI_1 RGCY 1 cut(s) 130
CviQI GTAC 1 cut(s) 245
DdeI CTNAG 1 cut(s) 14
Eco130I CCWWGG 1 cut(s) 38
Eco88I CYCGRG 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 179
EcoT14I CCWWGG 1 cut(s) 38
ErhI CCWWGG 1 cut(s) 38
FaeI CATG 2 cut(s) 139, 146
FaiI YATR 2 cut(s) 137, 144
FalI AAGNNNNNCTT 2 cut(s) 17, 49
FatI CATG 2 cut(s) 135, 142
FspBI CTAG 1 cut(s) 197
HaeIII GGCC 1 cut(s) 130
Hin1II CATG 2 cut(s) 139, 146
HinfI GANTC 1 cut(s) 269
HphI GGTGA 1 cut(s) 278
Hpy188I TCNGA 2 cut(s) 17, 274
HpyAV CCTTC 1 cut(s) 257
HpyCH4III ACNGT 2 cut(s) 64, 244
HpyCH4IV ACGT 1 cut(s) 247
HpyCH4V TGCA 2 cut(s) 105, 146
HpyF10VI GCNNNNNNNGC 2 cut(s) 34, 92
HpyF3I CTNAG 1 cut(s) 14
HpySE526I ACGT 1 cut(s) 247
Hsp92II CATG 2 cut(s) 139, 146
LpnPI CCDG 2 cut(s) 166, 193
MaeI CTAG 1 cut(s) 197
MaeII ACGT 1 cut(s) 247
MaeIII GTNAC 1 cut(s) 138
MluCI AATT 2 cut(s) 156, 168
MlyI GAGTC 1 cut(s) 278
MnlI CCTC 6 cut(s) 23, 117, 120, 250, 253, 271
MseI TTAA 1 cut(s) 288
MspR9I CCNGG 1 cut(s) 181
MvaI CCWGG 1 cut(s) 181
MwoI GCNNNNNNNGC 2 cut(s) 34, 92
NlaIII CATG 2 cut(s) 139, 146
NmuCI GTSAC 1 cut(s) 138
NspI RCATGY 2 cut(s) 139, 146
PciI ACATGT 1 cut(s) 135
PleI GAGTC 1 cut(s) 277
PpsI GAGTC 1 cut(s) 277
Ppu21I YACGTR 1 cut(s) 248
PscI ACATGT 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 179
PspGI CCWGG 1 cut(s) 179
RsaI GTAC 1 cut(s) 246
RsaNI GTAC 1 cut(s) 245
SaqAI TTAA 1 cut(s) 288
SchI GAGTC 1 cut(s) 278
ScrFI CCNGG 1 cut(s) 181
SetI ASST 3 cut(s) 44, 250, 268
Sse9I AATT 2 cut(s) 156, 168
SspMI CTAG 1 cut(s) 197
StyD4I CCNGG 1 cut(s) 179
StyI CCWWGG 1 cut(s) 38
TaaI ACNGT 2 cut(s) 64, 244
TaiI ACGT 1 cut(s) 250
TasI AATT 2 cut(s) 156, 168
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TscAI CASTG 1 cut(s) 153
TseFI GTSAC 1 cut(s) 138
Tsp45I GTSAC 1 cut(s) 138
TspRI CASTG 1 cut(s) 153
XapI RAATTY 1 cut(s) 156
XceI RCATGY 2 cut(s) 139, 146
XspI CTAG 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.