Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000281.1

Orthogroup ID

OG0008860

Physical Location & Seq

Genomic Coordinates Reverse (-)

123839 .. 124096

Gene Structure 258 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000281.1_g000032.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

atgcctcattcactactctttctcgtcgtgttccttgtcgccggctctgccagagacgacacatcagtcatgttgaggcttcgtgacggcctaaagcctaagcctagtggatggtcagccagtgatcactgcatgttggatggggtagagtgtgactataattatagagttgtgtccatcaatatggcctctaaggctttgtccggctttctccccccaaacctaaacgccctgacgaatgtcacttccaggggatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004675 GO:0004888 GO:0005575 GO:0005576 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0005886 GO:0005911 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007178 GO:0008150 GO:0008152 GO:0009506 GO:0009987 GO:0012505 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019199 GO:0019538 GO:0023052 GO:0030054 GO:0036211 GO:0038023 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0055044 GO:0060089 GO:0065007 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_4 LRR_8 Pkinase_Tyr

Protein Analysis

85

Amino Acids

9.23

Weight (kDa)

7.83

Isoelectric Point (pI)

32.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008860)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g20110 FvH4_4g20150 FvH4_4g20151 FvH4_4g20160 FvH4_4g20410
rosa_chinensis	RchiOBHm_Chr4g0425881 RchiOBHm_Chr7g0220551
rosa_laevigata	RLG00000002218 RLG00000007333
rosa_multiflora	Rmu_ssc0000189.1_g000033 Rmu_ssc0000189.1_g000034 Rmu_ssc0000281.1_g000028 Rmu_ssc0000281.1_g000029 Rmu_ssc0000281.1_g000030 Rmu_ssc0000281.1_g000031 Rmu_ssc0000281.1_g000032
rosa_roxburghii	Rroxscaffold_5G00367920
rosa_samantha	Rh4BG270100 Rh4DG266500 Rh7AG335700 Rh7AG335800 Rh7CG353400 Rh7CG353500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	65
AjnI	CCWGG	1 cut(s)	248
Alw26I	GTCTC	1 cut(s)	48
AoxI	GGCC	2 cut(s)	88, 186
BccI	CCATC	3 cut(s)	105, 134, 185
BceAI	ACGGC	1 cut(s)	103
BciT130I	CCWGG	1 cut(s)	250
BclI	TGATCA	1 cut(s)	124
BcoDI	GTCTC	1 cut(s)	48
BfaI	CTAG	1 cut(s)	105
BglI	GCCNNNNNGGC	1 cut(s)	194
Bme1390I	CCNGG	1 cut(s)	250
BmrFI	CCNGG	1 cut(s)	250
BoxI	GACNNNNGTC	1 cut(s)	239
Bpu10I	CCTNAGC	1 cut(s)	99
BsaJI	CCNNGG	1 cut(s)	249
Bse118I	RCCGGY	1 cut(s)	41
Bse1I	ACTGG	1 cut(s)	120
BseBI	CCWGG	1 cut(s)	250
BseDI	CCNNGG	1 cut(s)	249
BseGI	GGATG	2 cut(s)	116, 145
BseNI	ACTGG	1 cut(s)	120
BshFI	GGCC	2 cut(s)	90, 188
BsiSI	CCGG	2 cut(s)	42, 204
BsmAI	GTCTC	1 cut(s)	48
BsmBI	CGTCTC	1 cut(s)	48
BsnI	GGCC	2 cut(s)	90, 188
Bsp143I	GATC	1 cut(s)	124
BspANI	GGCC	2 cut(s)	90, 188
BsrFI	RCCGGY	1 cut(s)	41
BsrI	ACTGG	1 cut(s)	120
BssAI	RCCGGY	1 cut(s)	41
BssECI	CCNNGG	1 cut(s)	249
BssMI	GATC	1 cut(s)	124
Bst2UI	CCWGG	1 cut(s)	250
BstC8I	GCNNGC	1 cut(s)	43
BstDEI	CTNAG	2 cut(s)	99, 192
BstF5I	GGATG	2 cut(s)	116, 145
BstKTI	GATC	1 cut(s)	127
BstMAI	GTCTC	1 cut(s)	48
BstMBI	GATC	1 cut(s)	124
BstMWI	GCNNNNNNNGC	2 cut(s)	47, 194
BstNI	CCWGG	1 cut(s)	250
BstNSI	RCATGY	1 cut(s)	136
BstPAI	GACNNNNGTC	1 cut(s)	239
BstSCI	CCNGG	1 cut(s)	248
BstXI	CCANNNNNNTGG	1 cut(s)	184
BsuRI	GGCC	2 cut(s)	90, 188
BtsCI	GGATG	2 cut(s)	116, 145
BtsI	GCAGTG	1 cut(s)	127
BtsIMutI	CAGTG	2 cut(s)	127, 127
Cac8I	GCNNGC	1 cut(s)	43
Cfr10I	RCCGGY	1 cut(s)	41
CviAII	CATG	2 cut(s)	70, 133
CviJI	RGCY	9 cut(s)	45, 79, 90, 97, 103, 119, 188, 197, 207
CviKI_1	RGCY	9 cut(s)	45, 79, 90, 97, 103, 119, 188, 197, 207
DdeI	CTNAG	2 cut(s)	99, 192
DpnI	GATC	1 cut(s)	126
DpnII	GATC	1 cut(s)	124
DrdI	GACNNNNNNGTC	1 cut(s)	65
DseDI	GACNNNNNNGTC	1 cut(s)	65
EcoRII	CCWGG	1 cut(s)	248
Esp3I	CGTCTC	1 cut(s)	48
FaeI	CATG	2 cut(s)	73, 136
FaiI	YATR	5 cut(s)	71, 134, 159, 165, 185
FatI	CATG	2 cut(s)	69, 132
FbaI	TGATCA	1 cut(s)	124
FokI	GGATG	2 cut(s)	123, 152
FspBI	CTAG	1 cut(s)	105
HaeIII	GGCC	2 cut(s)	90, 188
HapII	CCGG	2 cut(s)	42, 204
Hin1II	CATG	2 cut(s)	73, 136
HpaII	CCGG	2 cut(s)	42, 204
Hpy188III	TCNNGA	1 cut(s)	83
Hpy99I	CGWCG	1 cut(s)	29
HpyCH4V	TGCA	1 cut(s)	132
HpyF10VI	GCNNNNNNNGC	2 cut(s)	47, 194
HpyF3I	CTNAG	2 cut(s)	99, 192
Hsp92II	CATG	2 cut(s)	73, 136
KroI	GCCGGC	1 cut(s)	41
KroNI	GCCGGC	1 cut(s)	43
Ksp22I	TGATCA	1 cut(s)	124
Kzo9I	GATC	1 cut(s)	124
LpnPI	CCDG	6 cut(s)	55, 64, 133, 217, 235, 245
MaeI	CTAG	1 cut(s)	105
MaeIII	GTNAC	3 cut(s)	83, 152, 241
MalI	GATC	1 cut(s)	126
MboI	GATC	1 cut(s)	124
MluCI	AATT	1 cut(s)	160
MmeI	TCCRAC	1 cut(s)	117
MnlI	CCTC	3 cut(s)	15, 69, 199
MroNI	GCCGGC	1 cut(s)	41
MslI	CAYNNNNRTG	1 cut(s)	182
MspI	CCGG	2 cut(s)	42, 204
MspR9I	CCNGG	1 cut(s)	250
MvaI	CCWGG	1 cut(s)	250
MwoI	GCNNNNNNNGC	2 cut(s)	47, 194
NaeI	GCCGGC	1 cut(s)	43
NdeII	GATC	1 cut(s)	124
NgoMIV	GCCGGC	1 cut(s)	41
NlaIII	CATG	2 cut(s)	73, 136
NmuCI	GTSAC	3 cut(s)	83, 152, 241
NspI	RCATGY	1 cut(s)	136
PdiI	GCCGGC	1 cut(s)	43
PshAI	GACNNNNGTC	1 cut(s)	239
Psp6I	CCWGG	1 cut(s)	248
PspGI	CCWGG	1 cut(s)	248
RseI	CAYNNNNRTG	1 cut(s)	182
Sau3AI	GATC	1 cut(s)	124
ScrFI	CCNGG	1 cut(s)	250
SetI	ASST	1 cut(s)	225
SmiMI	CAYNNNNRTG	1 cut(s)	182
Sse9I	AATT	1 cut(s)	160
SspMI	CTAG	1 cut(s)	105
StyD4I	CCNGG	1 cut(s)	248
TasI	AATT	1 cut(s)	160
TscAI	CASTG	2 cut(s)	127, 134
TseFI	GTSAC	3 cut(s)	83, 152, 241
Tsp45I	GTSAC	3 cut(s)	83, 152, 241
TspRI	CASTG	2 cut(s)	127, 134
XceI	RCATGY	1 cut(s)	136
XspI	CTAG	1 cut(s)	105

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.