Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000218.1

Orthogroup ID

OG0005878

Physical Location & Seq

Genomic Coordinates Forward (+)

48397 .. 52957

Gene Structure 4561 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000218.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1674 bp

atggcggcggccaccaccaccactagaggcttcgcgactcaccccagccacctctccttcctccatcacctaccgcatccgctccggaacaatgctcaccccgccgacgtggacgagctgagcaagcggcggaggctcaccatcggcggaaaccgagtcggagcgagtcgaatcagttgctgctgttccgactcggcggttccgattcggagcagctcccccgccgagaagaggaacaagtgcgatgagcggcggttcgattccaacaagaggcctcctcacagagctggactcaaagctgctgctgcattgccctttgcttctgagcaatctcaatttgcctccaaacaaaacagcaaggtgaaccctcgccgccgccctcgctgtactccggggactactggtccacaatctcgtgatactccgccgaaaagagtcggggcgagtcgaatcagttgctgctgttccgactcggcggttccgattcggagcagctcccccgccgagaagaggaacaagtgcgatgagcggcggttcgattccaacaagaggcctcctcacagagctggactcaaagctgctgctgcattgccctttgcttctgagcaatctcaatttgcctccaaacaaaacagcaaggtgaaccctcgccgccgccctcgctgtactccggggactactggtccacaatctcgtgatactccaccgaaaagagatactggtattgccagtgagaaggaatggggtattagcttgttaaacgaacatgtgaaggaatccggcactaatgaagatggaagtacttggtaccgagaaagcgggcaggagctggggaacactgggtacagatgtaggtggacaaggatgggtggtgcttctcatgactcctcttcagagtggagagaagagtggtgggagaaaagtgactggaccggatacaaagagctaggtgtggagaaatctggtagaaatgccgaaggggattcatggtgggaaacctggcaagaggttcttcatcaagatgaatggagtaacctagcaaggattgagagaagtgcacagaaacgagcaaaatcaggcactgaaaatgctggatggtctgagaaatggtgggagaaatatgatgccaaaggctggactgagaaaggagcacacaaatggggtagacttaatgaacagtcttggtgggagaagtggggagagcattatgacggaaggggatcagttctcaaatggacagataaatgggcagagactgaacttggaaccaaatggggagacaagtgggaagagaagttctttgagggtataggttcacgacaaggggaaacatggcatgtaacttccaatgatgaccgttggtcaaggacatggggagaagaacacataggaaatggtaaagtgcacaaatatgggaagagcacaacaggtgaaagctgggatattgttgtggatgaggagacctattatgaggctgtgccgcattacggatgggcagatgttgtaggcgattctacccagttactatcaattgaacctcgtgaaaagccgcctgaggtctacccaaactttgactttacgagatcaccacctgcaatgggtacaccgcttccagagaatgaaccaccaccaccatcaccacctacagaggatgaaccacctccggaagattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

557

Amino Acids

63.07

Weight (kDa)

8.36

Isoelectric Point (pI)

63.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005878)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G42430 AT1G42430
fragaria_vesca	FvH4_2g37530 FvH4_2g37530 FvH4_2g37530 FvH4_2g37530 FvH4_2g37530
malus_domestica	MD07G1011800.v1.1 MD08G1002900.v1.1 MD11G1103700.v1.1 MD15G1002600.v1.1
prunus_persica	Prupe.1G354900_v2.0.a1
pyrus_communis	pycom08g00240 pycom15g00150
rosa_chinensis	RchiOBHm_Chr6g0304201
rosa_laevigata	RLG00000011007
rosa_multiflora	Rmu_co8390907.1_g000001 Rmu_ssc0000218.1_g000011
rosa_roxburghii	Rroxscaffold_7G00163980
rosa_rugosa	Rorug06G0328400 Rorug06G0328500 Rorug06G0328600 Rorug06G0328700
rosa_samantha	Rh6AG442500 Rh6BG460200 Rh6CG454700 Rh6DG441900
rosa_wichuraiana	Rw6G038360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	1600
Acc36I	ACCTGC	1 cut(s)	1600
Acc65I	GGTACC	1 cut(s)	807
AccB1I	GGYRCC	1 cut(s)	807
AccB7I	CCANNNNNTGG	1 cut(s)	1134
AccBSI	CCGCTC	3 cut(s)	82, 250, 529
AccI	GTMKAC	2 cut(s)	1165, 1560
AccII	CGCG	1 cut(s)	35
AccIII	TCCGGA	2 cut(s)	84, 1663
AclWI	GGATC	1 cut(s)	1228
AcoI	YGGCCR	1 cut(s)	9
AcuI	CTGAAG	1 cut(s)	876
AfaI	GTAC	6 cut(s)	388, 667, 802, 809, 845, 1603
AfiI	CCNNNNNNNGG	7 cut(s)	231, 270, 510, 549, 1134, 1487, 1598
AflIII	ACRYGT	1 cut(s)	766
AgsI	TTSAA	1 cut(s)	1535
AhdI	GACNNNNNGTC	3 cut(s)	402, 681, 1360
AjiI	CACGTC	1 cut(s)	109
AjnI	CCWGG	1 cut(s)	998
AloI	GAACNNNNNNTCC	2 cut(s)	1280, 1312
Alw21I	GWGCWC	4 cut(s)	1060, 1153, 1407, 1424
Alw26I	GTCTC	3 cut(s)	1247, 1272, 1454
Alw44I	GTGCAC	2 cut(s)	1056, 1403
AlwI	GGATC	1 cut(s)	1228
AlwNI	CAGNNNCTG	5 cut(s)	180, 459, 829, 1082, 1256
Aor13HI	TCCGGA	2 cut(s)	84, 1663
AoxI	GGCC	3 cut(s)	9, 272, 551
ApaLI	GTGCAC	2 cut(s)	1056, 1403
Asp718I	GGTACC	1 cut(s)	807
AspS9I	GGNCC	3 cut(s)	404, 683, 930
AsuC2I	CCSGG	2 cut(s)	393, 672
AsuHPI	GGTGA	9 cut(s)	32, 59, 89, 130, 373, 652, 1442, 1578, 1629
AvaII	GGWCC	3 cut(s)	404, 683, 930
AxyI	CCTNAGG	1 cut(s)	1554
BaeGI	GKGCMC	2 cut(s)	1060, 1407
BaeI	ACNNNNGTAYC	2 cut(s)	835, 868
BanI	GGYRCC	1 cut(s)	807
BauI	CACGAG	3 cut(s)	414, 693, 1539
Bbv12I	GWGCWC	4 cut(s)	1060, 1153, 1407, 1424
BccI	CCATC	7 cut(s)	72, 149, 788, 859, 1089, 1485, 1642
BcgI	CGANNNNNNTGC	4 cut(s)	159, 193, 438, 472
BciT130I	CCWGG	1 cut(s)	1000
BciVI	GTATCC	1 cut(s)	929
BcnI	CCSGG	2 cut(s)	393, 672
BcoDI	GTCTC	3 cut(s)	1247, 1272, 1454
BfaI	CTAG	3 cut(s)	24, 947, 1037
BfmI	CTRYAG	1 cut(s)	1644
BfuAI	ACCTGC	1 cut(s)	1600
BfuI	GTATCC	1 cut(s)	929
BlpI	GCTNAGC	1 cut(s)	119
BmcAI	AGTACT	1 cut(s)	802
Bme1390I	CCNGG	3 cut(s)	393, 672, 1000
Bme18I	GGWCC	3 cut(s)	404, 683, 930
BmeRI	GACNNNNNGTC	3 cut(s)	402, 681, 1360
BmgBI	CACGTC	1 cut(s)	109
BmgT120I	GGNCC	3 cut(s)	404, 683, 930
BmiI	GGNNCC	4 cut(s)	201, 480, 809, 1267
BmrFI	CCNGG	3 cut(s)	393, 672, 1000
BmrI	ACTGGG	2 cut(s)	849, 1513
BmsI	GCATC	2 cut(s)	85, 1114
BmuI	ACTGGG	2 cut(s)	849, 1513
BplI	GAGNNNNNCTC	8 cut(s)	262, 294, 276, 308, 541, 573, 555, 587
Bpu1102I	GCTNAGC	1 cut(s)	119
BpuMI	CCSGG	2 cut(s)	393, 672
BsaI	GGTCTC	1 cut(s)	1454
BsaJI	CCNNGG	2 cut(s)	392, 671
BsaWI	WCCGGW	3 cut(s)	84, 932, 1663
Bsc4I	CCNNNNNNNGG	7 cut(s)	231, 270, 510, 549, 1134, 1487, 1598
Bse1I	ACTGG	7 cut(s)	406, 685, 724, 729, 844, 932, 1519
Bse21I	CCTNAGG	1 cut(s)	1554
Bse3DI	GCAATG	3 cut(s)	308, 587, 1602
BseAI	TCCGGA	2 cut(s)	84, 1663
BseBI	CCWGG	1 cut(s)	1000
BseDI	CCNNGG	2 cut(s)	392, 671
BseGI	GGATG	6 cut(s)	76, 870, 1100, 1459, 1496, 1657
BseLI	CCNNNNNNNGG	7 cut(s)	231, 270, 510, 549, 1134, 1487, 1598
BseMI	GCAATG	3 cut(s)	308, 587, 1602
BseMII	CTCAG	6 cut(s)	110, 315, 594, 1092, 1131, 1545
BseNI	ACTGG	7 cut(s)	406, 685, 724, 729, 844, 932, 1519
BseRI	GAGGAG	4 cut(s)	267, 546, 877, 1472
BseSI	GKGCMC	2 cut(s)	1060, 1407
BseYI	CCCAGC	3 cut(s)	44, 829, 1437
Bsh1236I	CGCG	1 cut(s)	35
BshFI	GGCC	3 cut(s)	11, 274, 553
BshNI	GGYRCC	1 cut(s)	807
BsiHKAI	GWGCWC	4 cut(s)	1060, 1153, 1407, 1424
BsiSI	CCGG	6 cut(s)	85, 392, 671, 780, 933, 1664
BslFI	GGGAC	2 cut(s)	409, 688
BslI	CCNNNNNNNGG	7 cut(s)	231, 270, 510, 549, 1134, 1487, 1598
BsmAI	GTCTC	3 cut(s)	1247, 1272, 1454
BsmFI	GGGAC	2 cut(s)	409, 688
BsnI	GGCC	3 cut(s)	11, 274, 553
Bso31I	GGTCTC	1 cut(s)	1454
Bsp1286I	GDGCHC	4 cut(s)	1060, 1153, 1407, 1424
Bsp13I	TCCGGA	2 cut(s)	84, 1663
Bsp143I	GATC	2 cut(s)	1220, 1583
Bsp1720I	GCTNAGC	1 cut(s)	119
Bsp68I	TCGCGA	1 cut(s)	35
BspANI	GGCC	3 cut(s)	11, 274, 553
BspCNI	CTCAG	6 cut(s)	111, 316, 595, 1093, 1132, 1546
BspEI	TCCGGA	2 cut(s)	84, 1663
BspFNI	CGCG	1 cut(s)	35
BspHI	TCATGA	1 cut(s)	880
BspLI	GGNNCC	4 cut(s)	201, 480, 809, 1267
BspMI	ACCTGC	1 cut(s)	1600
BspPI	GGATC	1 cut(s)	1228
BspQI	GCTCTTC	1 cut(s)	1412
BspT107I	GGYRCC	1 cut(s)	807
BspTNI	GGTCTC	1 cut(s)	1454
BsrBI	CCGCTC	3 cut(s)	82, 250, 529
BsrDI	GCAATG	3 cut(s)	308, 587, 1602
BsrI	ACTGG	7 cut(s)	406, 685, 724, 729, 844, 932, 1519
BssECI	CCNNGG	2 cut(s)	392, 671
BssMI	GATC	2 cut(s)	1220, 1583
BssSI	CACGAG	3 cut(s)	414, 693, 1539
Bst2BI	CACGAG	3 cut(s)	414, 693, 1539
Bst2UI	CCWGG	1 cut(s)	1000
Bst4CI	ACNGT	2 cut(s)	1179, 1358
Bst6I	CTCTTC	6 cut(s)	224, 503, 895, 900, 1284, 1412
BstC8I	GCNNGC	2 cut(s)	125, 821
BstDEI	CTNAG	6 cut(s)	119, 324, 603, 1101, 1140, 1554
BstF5I	GGATG	6 cut(s)	76, 870, 1100, 1459, 1496, 1657
BstFNI	CGCG	1 cut(s)	35
BstKTI	GATC	2 cut(s)	1223, 1586
BstMAI	GTCTC	3 cut(s)	1247, 1272, 1454
BstMBI	GATC	2 cut(s)	1220, 1583
BstMWI	GCNNNNNNNGC	7 cut(s)	101, 124, 133, 305, 381, 584, 660
BstNI	CCWGG	1 cut(s)	1000
BstNSI	RCATGY	2 cut(s)	770, 1340
BstSCI	CCNGG	3 cut(s)	391, 670, 998
BstSFI	CTRYAG	1 cut(s)	1644
BstSLI	GKGCMC	2 cut(s)	1060, 1407
BstUI	CGCG	1 cut(s)	35
Bsu36I	CCTNAGG	1 cut(s)	1554
BsuI	GTATCC	1 cut(s)	929
BsuRI	GGCC	3 cut(s)	11, 274, 553
BtgZI	GCGATG	2 cut(s)	258, 537
BtrI	CACGTC	1 cut(s)	109
BtsCI	GGATG	6 cut(s)	76, 870, 1100, 1459, 1496, 1657
BtsIMutI	CAGTG	3 cut(s)	736, 837, 1080
BtuMI	TCGCGA	1 cut(s)	35
BveI	ACCTGC	1 cut(s)	1600
Cac8I	GCNNGC	2 cut(s)	125, 821
CaiI	CAGNNNCTG	5 cut(s)	180, 459, 829, 1082, 1256
CciI	TCATGA	1 cut(s)	880
Cfr13I	GGNCC	3 cut(s)	404, 683, 930
Csp6I	GTAC	6 cut(s)	387, 666, 801, 808, 844, 1602
CviAII	CATG	6 cut(s)	767, 881, 987, 1332, 1337, 1371
CviQI	GTAC	6 cut(s)	387, 666, 801, 808, 844, 1602
DdeI	CTNAG	6 cut(s)	119, 324, 603, 1101, 1140, 1554
DpnI	GATC	2 cut(s)	1222, 1585
DpnII	GATC	2 cut(s)	1220, 1583
DriI	GACNNNNNGTC	3 cut(s)	402, 681, 1360
EaeI	YGGCCR	1 cut(s)	9
Eam1104I	CTCTTC	6 cut(s)	224, 503, 895, 900, 1284, 1412
Eam1105I	GACNNNNNGTC	3 cut(s)	402, 681, 1360
EarI	CTCTTC	6 cut(s)	224, 503, 895, 900, 1284, 1412
EciI	GGCGGA	3 cut(s)	145, 162, 414
Eco147I	AGGCCT	2 cut(s)	274, 553
Eco31I	GGTCTC	1 cut(s)	1454
Eco47I	GGWCC	3 cut(s)	404, 683, 930
Eco57I	CTGAAG	1 cut(s)	876
Eco81I	CCTNAGG	1 cut(s)	1554
EcoRII	CCWGG	1 cut(s)	998
FaeI	CATG	6 cut(s)	770, 884, 990, 1335, 1340, 1374
FalI	AAGNNNNNCTT	2 cut(s)	996, 1028
FaqI	GGGAC	2 cut(s)	409, 688
FatI	CATG	6 cut(s)	766, 880, 986, 1331, 1336, 1370
FauI	CCCGC	4 cut(s)	109, 229, 508, 812
FblI	GTMKAC	2 cut(s)	1165, 1560
FokI	GGATG	6 cut(s)	63, 877, 1107, 1466, 1503, 1664
FspBI	CTAG	3 cut(s)	24, 947, 1037
GsaI	CCCAGC	3 cut(s)	48, 833, 1441
HaeIII	GGCC	3 cut(s)	11, 274, 553
HapII	CCGG	6 cut(s)	85, 392, 671, 780, 933, 1664
Hin1II	CATG	6 cut(s)	770, 884, 990, 1335, 1340, 1374
HpaII	CCGG	6 cut(s)	85, 392, 671, 780, 933, 1664
HphI	GGTGA	9 cut(s)	32, 59, 89, 130, 373, 652, 1442, 1578, 1629
Hpy99I	CGWCG	1 cut(s)	110
HpyAV	CCTTC	5 cut(s)	67, 730, 766, 971, 1209
HpyCH4III	ACNGT	2 cut(s)	1179, 1358
HpyCH4IV	ACGT	1 cut(s)	108
HpyCH4V	TGCA	5 cut(s)	308, 587, 1058, 1405, 1595
HpyF10VI	GCNNNNNNNGC	7 cut(s)	101, 124, 133, 305, 381, 584, 660
HpyF3I	CTNAG	6 cut(s)	119, 324, 603, 1101, 1140, 1554
HpySE526I	ACGT	1 cut(s)	108
Hsp92II	CATG	6 cut(s)	770, 884, 990, 1335, 1340, 1374
Kpn2I	TCCGGA	2 cut(s)	84, 1663
KpnI	GGTACC	1 cut(s)	811
Kzo9I	GATC	2 cut(s)	1220, 1583
LguI	GCTCTTC	1 cut(s)	1412
LmnI	GCTCC	8 cut(s)	87, 161, 210, 221, 489, 500, 826, 1148
LweI	GCATC	2 cut(s)	85, 1114
MaeI	CTAG	3 cut(s)	24, 947, 1037
MaeII	ACGT	1 cut(s)	108
MaeIII	GTNAC	4 cut(s)	923, 1031, 1339, 1521
MalI	GATC	2 cut(s)	1222, 1585
MbiI	CCGCTC	3 cut(s)	82, 250, 529
MboI	GATC	2 cut(s)	1220, 1583
MboII	GAAGA	9 cut(s)	241, 520, 803, 882, 917, 1004, 1301, 1391, 1429
MfeI	CAATTG	1 cut(s)	1530
MhlI	GDGCHC	4 cut(s)	1060, 1153, 1407, 1424
MluCI	AATT	3 cut(s)	335, 614, 1530
MmeI	TCCRAC	5 cut(s)	139, 213, 288, 492, 567
MroI	TCCGGA	2 cut(s)	84, 1663
MseI	TTAA	3 cut(s)	758, 1170, 1672
MslI	CAYNNNNRTG	3 cut(s)	1020, 1156, 1410
MspI	CCGG	6 cut(s)	85, 392, 671, 780, 933, 1664
MspR9I	CCNGG	3 cut(s)	393, 672, 1000
MunI	CAATTG	1 cut(s)	1530
MvaI	CCWGG	1 cut(s)	1000
MvnI	CGCG	1 cut(s)	35
MwoI	GCNNNNNNNGC	7 cut(s)	101, 124, 133, 305, 381, 584, 660
NciI	CCSGG	2 cut(s)	393, 672
NdeII	GATC	2 cut(s)	1220, 1583
NlaIII	CATG	6 cut(s)	770, 884, 990, 1335, 1340, 1374
NlaIV	GGNNCC	4 cut(s)	201, 480, 809, 1267
NmeAIII	GCCGAG	4 cut(s)	173, 250, 452, 529
NmuCI	GTSAC	1 cut(s)	923
NruI	TCGCGA	1 cut(s)	35
NspI	RCATGY	2 cut(s)	770, 1340
PagI	TCATGA	1 cut(s)	880
PaqCI	CACCTGC	1 cut(s)	1600
PceI	AGGCCT	2 cut(s)	274, 553
PciI	ACATGT	1 cut(s)	766
PciSI	GCTCTTC	1 cut(s)	1412
PcsI	WCGNNNNNNNCGW	2 cut(s)	200, 479
PfeI	GAWTC	9 cut(s)	171, 205, 260, 450, 484, 539, 776, 983, 1511
PflMI	CCANNNNNTGG	1 cut(s)	1134
PscI	ACATGT	1 cut(s)	766
Psp6I	CCWGG	1 cut(s)	998
PspFI	CCCAGC	3 cut(s)	44, 829, 1437
PspGI	CCWGG	1 cut(s)	998
PspN4I	GGNNCC	4 cut(s)	201, 480, 809, 1267
PspPI	GGNCC	3 cut(s)	404, 683, 930
PsrI	GAACNNNNNNTAC	2 cut(s)	827, 859
PstNI	CAGNNNCTG	5 cut(s)	180, 459, 829, 1082, 1256
RruI	TCGCGA	1 cut(s)	35
RsaI	GTAC	6 cut(s)	388, 667, 802, 809, 845, 1603
RsaNI	GTAC	6 cut(s)	387, 666, 801, 808, 844, 1602
RseI	CAYNNNNRTG	3 cut(s)	1020, 1156, 1410
SapI	GCTCTTC	1 cut(s)	1412
SaqAI	TTAA	3 cut(s)	758, 1170, 1672
Sau3AI	GATC	2 cut(s)	1220, 1583
Sau96I	GGNCC	3 cut(s)	404, 683, 930
ScaI	AGTACT	1 cut(s)	802
ScrFI	CCNGG	3 cut(s)	393, 672, 1000
SduI	GDGCHC	4 cut(s)	1060, 1153, 1407, 1424
SfaNI	GCATC	2 cut(s)	85, 1114
SfcI	CTRYAG	1 cut(s)	1644
SinI	GGWCC	3 cut(s)	404, 683, 930
SmiMI	CAYNNNNRTG	3 cut(s)	1020, 1156, 1410
Sse9I	AATT	3 cut(s)	335, 614, 1530
SseBI	AGGCCT	2 cut(s)	274, 553
SspMI	CTAG	3 cut(s)	24, 947, 1037
StuI	AGGCCT	2 cut(s)	274, 553
StyD4I	CCNGG	3 cut(s)	391, 670, 998
TaaI	ACNGT	2 cut(s)	1179, 1358
TaiI	ACGT	1 cut(s)	111
TaqI	TCGA	4 cut(s)	169, 258, 448, 537
TasI	AATT	3 cut(s)	335, 614, 1530
TatI	WGTACW	3 cut(s)	386, 665, 800
TfiI	GAWTC	9 cut(s)	171, 205, 260, 450, 484, 539, 776, 983, 1511
Tru1I	TTAA	3 cut(s)	758, 1170, 1672
Tru9I	TTAA	3 cut(s)	758, 1170, 1672
TscAI	CASTG	3 cut(s)	736, 844, 1087
TseFI	GTSAC	1 cut(s)	923
Tsp45I	GTSAC	1 cut(s)	923
TspDTI	ATGAA	7 cut(s)	804, 975, 1004, 1038, 1188, 1635, 1668
TspGWI	ACGGA	2 cut(s)	1227, 1503
TspRI	CASTG	3 cut(s)	736, 844, 1087
Van91I	CCANNNNNTGG	1 cut(s)	1134
VneI	GTGCAC	2 cut(s)	1056, 1403
VpaK11BI	GGWCC	3 cut(s)	404, 683, 930
XceI	RCATGY	2 cut(s)	770, 1340
XmiI	GTMKAC	2 cut(s)	1165, 1560
XspI	CTAG	3 cut(s)	24, 947, 1037
ZrmI	AGTACT	1 cut(s)	802

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.