Rmu_ssc0000233.1_g000009

Belongs to the peroxidase family. Classical plant (class III) peroxidase subfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000233.1
Physical Location & Seq
Forward (+)
46145 .. 48132
1988 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000233.1_g000009.1.cds

Sequence Viewer

Length: 1065 bp
atgaatcccatagtttcttcgctctttgtcctcctcgttgttgttcagttgagtccaaccttatcatacccagcagatgatcaccatgacgatgataatgaatcacctgaacactggaagggtgccacacctctaacggttccgaccattttagagaacttaccctttggggattttctatcctttgctcactaccacaggagttgtccagaccttgaaggcattatcaataggaaattgaagcaatggcttaagcaggactacaccatagctgctagtctcatgaggttgcacttccatgactgtgccatcaggggatgtgatgcctccatcttattaaaccatgagggaagtgagagaactgccttggccagcaagacactaagagggtttgaagtgatagatgatatcaaagcagaggtcgagaagaagtgccccaaaacagtatcttgtgcagatatcttgactgcagctacaagagatgccactgttatggtcggcggtccatactggatggtcccctatggtcggaaggatgggcgagtttcaattgccaaggaagctgaatgggtgccgatgggtcatgaaaacattactgctttggttgagtttttccaatctcagggcttgaatgtgcttgacttggttgttctctcaggggcacacaccataggaaggtcttcatgtgcttccatacaaaacaggctctttaacttcgatggatatgggaactctgatccatccattgatgaaaaatacttgaacttcttgaaaagaaaatgcagatggggatcagactatgttgaccttgatgctacaactccaaaaacctttgacactgcatactactccaatctgcagaggaagatgggacttctcaaaacagatcaattgttgtattctgatacaaggacttcaccacttgtcaccgctttagctcaccagcccgcagtcttctaccaccagtttggagtctccatggccaaactggggaatgttcaagtcctcacaggccaagatgaaggcgaaattcgaaccaactgcaattttgtcaactcttattga

Protein Analysis

354

Amino Acids

39.55

Weight (kDa)

5.83

Isoelectric Point (pI)

33.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 122, 571
AciI CCGC 3 cut(s) 501, 930, 948
AclWI GGATC 2 cut(s) 731, 799
AcoI YGGCCR 2 cut(s) 369, 981
AcsI RAATTY 1 cut(s) 1029
AfiI CCNNNNNNNGG 4 cut(s) 528, 622, 675, 990
AflII CTTAAG 1 cut(s) 251
AgsI TTSAA 8 cut(s) 218, 241, 395, 549, 631, 763, 772, 1001
AluBI AGCT 4 cut(s) 272, 473, 563, 938
AluI AGCT 4 cut(s) 272, 473, 563, 938
Alw26I GTCTC 2 cut(s) 284, 979
AlwI GGATC 2 cut(s) 731, 799
AoxI GGCC 3 cut(s) 369, 981, 1012
ApeKI GCWGC 2 cut(s) 272, 470
ApoI RAATTY 1 cut(s) 1029
ArsI GACNNNNNNTTYG 2 cut(s) 405, 437
Asp700I GAANNNNTTC 1 cut(s) 679
AspS9I GGNCC 2 cut(s) 503, 517
AsuHPI GGTGA 5 cut(s) 74, 96, 909, 919, 932
AsuII TTCGAA 1 cut(s) 1033
AvaII GGWCC 2 cut(s) 503, 517
BaeGI GKGCMC 2 cut(s) 437, 664
BalI TGGCCA 2 cut(s) 371, 983
BanI GGYRCC 2 cut(s) 122, 571
BbsI GAAGAC 2 cut(s) 672, 946
BbvI GCAGC 2 cut(s) 259, 482
BccI CCATC 9 cut(s) 317, 338, 508, 530, 571, 713, 748, 780, 862
BcgI CGANNNNNNTGC 2 cut(s) 1023, 1057
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 2 cut(s) 284, 979
BfaI CTAG 1 cut(s) 276
BfmI CTRYAG 2 cut(s) 468, 857
BfrI CTTAAG 1 cut(s) 251
BisI GCNGC 2 cut(s) 273, 471
BlsI GCNGC 2 cut(s) 274, 472
Bme18I GGWCC 2 cut(s) 503, 517
BmgT120I GGNCC 2 cut(s) 503, 517
BmiI GGNNCC 4 cut(s) 124, 141, 519, 573
BmrI ACTGGG 1 cut(s) 998
BmsI GCATC 3 cut(s) 313, 472, 802
BmuI ACTGGG 1 cut(s) 998
BpiI GAAGAC 2 cut(s) 672, 946
Bpu14I TTCGAA 1 cut(s) 1033
BsaBI GATNNNNATC 1 cut(s) 790
BsaJI CCNNGG 3 cut(s) 366, 555, 978
Bsc4I CCNNNNNNNGG 4 cut(s) 528, 622, 675, 990
Bse1I ACTGG 4 cut(s) 119, 515, 964, 993
Bse3DI GCAATG 1 cut(s) 251
Bse8I GATNNNNATC 1 cut(s) 790
BseDI CCNNGG 3 cut(s) 366, 555, 978
BseGI GGATG 4 cut(s) 323, 519, 541, 740
BseJI GATNNNNATC 1 cut(s) 790
BseLI CCNNNNNNNGG 4 cut(s) 528, 622, 675, 990
BseMI GCAATG 1 cut(s) 251
BseMII CTCAG 2 cut(s) 635, 669
BseNI ACTGG 4 cut(s) 119, 515, 964, 993
BseRI GAGGAG 1 cut(s) 23
BseSI GKGCMC 2 cut(s) 437, 664
BseXI GCAGC 2 cut(s) 259, 482
BseYI CCCAGC 1 cut(s) 70
BsgI GTGCAG 1 cut(s) 474
BshFI GGCC 3 cut(s) 371, 983, 1014
BshNI GGYRCC 2 cut(s) 122, 571
BslFI GGGAC 2 cut(s) 503, 885
BslI CCNNNNNNNGG 4 cut(s) 528, 622, 675, 990
BsmAI GTCTC 2 cut(s) 284, 979
BsmFI GGGAC 2 cut(s) 503, 885
BsnI GGCC 3 cut(s) 371, 983, 1014
Bsp119I TTCGAA 1 cut(s) 1033
Bsp1286I GDGCHC 2 cut(s) 437, 664
Bsp143I GATC 4 cut(s) 79, 736, 791, 886
Bsp19I CCATGG 1 cut(s) 978
BspACI CCGC 3 cut(s) 501, 930, 948
BspANI GGCC 3 cut(s) 371, 983, 1014
BspCNI CTCAG 2 cut(s) 634, 668
BspHI TCATGA 2 cut(s) 282, 583
BspLI GGNNCC 4 cut(s) 124, 141, 519, 573
BspMAI CTGCAG 2 cut(s) 472, 861
BspPI GGATC 2 cut(s) 731, 799
BspT104I TTCGAA 1 cut(s) 1033
BspT107I GGYRCC 2 cut(s) 122, 571
BspTI CTTAAG 1 cut(s) 251
BsrDI GCAATG 1 cut(s) 251
BsrI ACTGG 4 cut(s) 119, 515, 964, 993
BssECI CCNNGG 3 cut(s) 366, 555, 978
BssMI GATC 4 cut(s) 79, 736, 791, 886
BssT1I CCWWGG 3 cut(s) 366, 555, 978
Bst4CI ACNGT 4 cut(s) 139, 305, 445, 490
BstAFI CTTAAG 1 cut(s) 251
BstBI TTCGAA 1 cut(s) 1033
BstC8I GCNNGC 2 cut(s) 373, 948
BstDEI CTNAG 3 cut(s) 383, 621, 655
BstDSI CCRYGG 1 cut(s) 978
BstF5I GGATG 4 cut(s) 323, 519, 541, 740
BstKTI GATC 4 cut(s) 82, 739, 794, 889
BstMAI GTCTC 2 cut(s) 284, 979
BstMBI GATC 4 cut(s) 79, 736, 791, 886
BstMWI GCNNNNNNNGC 1 cut(s) 560
BstSFI CTRYAG 2 cut(s) 468, 857
BstSLI GKGCMC 2 cut(s) 437, 664
BstV1I GCAGC 2 cut(s) 259, 482
BstV2I GAAGAC 2 cut(s) 672, 946
BstXI CCANNNNNNTGG 2 cut(s) 493, 968
BsuRI GGCC 3 cut(s) 371, 983, 1014
BtgI CCRYGG 1 cut(s) 978
BtsCI GGATG 4 cut(s) 323, 519, 541, 740
BtsI GCAGTG 1 cut(s) 837
BtsIMutI CAGTG 3 cut(s) 112, 486, 837
Cac8I GCNNGC 2 cut(s) 373, 948
CciI TCATGA 2 cut(s) 282, 583
Cfr13I GGNCC 2 cut(s) 503, 517
CspCI CAANNNNNGTGG 2 cut(s) 185, 220
CviAII CATG 7 cut(s) 86, 283, 299, 344, 584, 684, 979
DdeI CTNAG 3 cut(s) 383, 621, 655
DpnI GATC 4 cut(s) 81, 738, 793, 888
DpnII GATC 4 cut(s) 79, 736, 791, 886
EaeI YGGCCR 2 cut(s) 369, 981
Eco130I CCWWGG 3 cut(s) 366, 555, 978
Eco32I GATATC 2 cut(s) 409, 460
Eco47I GGWCC 2 cut(s) 503, 517
EcoRV GATATC 2 cut(s) 409, 460
EcoT14I CCWWGG 3 cut(s) 366, 555, 978
ErhI CCWWGG 3 cut(s) 366, 555, 978
FaeI CATG 7 cut(s) 89, 286, 302, 347, 587, 687, 982
FaqI GGGAC 2 cut(s) 503, 885
FatI CATG 7 cut(s) 85, 282, 298, 343, 583, 683, 978
FauI CCCGC 1 cut(s) 955
FbaI TGATCA 1 cut(s) 79
Fnu4HI GCNGC 2 cut(s) 273, 471
FokI GGATG 4 cut(s) 330, 526, 548, 727
Fsp4HI GCNGC 2 cut(s) 273, 471
FspBI CTAG 1 cut(s) 276
GluI GCNGC 2 cut(s) 273, 471
GsaI CCCAGC 1 cut(s) 74
HaeIII GGCC 3 cut(s) 371, 983, 1014
Hin1II CATG 7 cut(s) 89, 286, 302, 347, 587, 687, 982
HincII GTYRAC 2 cut(s) 805, 1054
HindII GTYRAC 2 cut(s) 805, 1054
HinfI GANTC 4 cut(s) 4, 52, 101, 972
HphI GGTGA 5 cut(s) 74, 96, 909, 919, 932
Hpy166II GTNNAC 2 cut(s) 805, 1054
Hpy188I TCNGA 5 cut(s) 144, 531, 736, 796, 904
Hpy188III TCNNGA 6 cut(s) 209, 283, 424, 463, 584, 769
Hpy8I GTNNAC 2 cut(s) 805, 1054
HpyAV CCTTC 5 cut(s) 112, 212, 526, 669, 1016
HpyCH4III ACNGT 4 cut(s) 139, 305, 445, 490
HpyCH4V TGCA 7 cut(s) 292, 455, 470, 783, 842, 859, 1044
HpyF10VI GCNNNNNNNGC 1 cut(s) 560
HpyF3I CTNAG 3 cut(s) 383, 621, 655
Hsp92II CATG 7 cut(s) 89, 286, 302, 347, 587, 687, 982
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 4 cut(s) 79, 736, 791, 886
Lsp1109I GCAGC 2 cut(s) 259, 482
LweI GCATC 3 cut(s) 313, 472, 802
MaeI CTAG 1 cut(s) 276
MaeIII GTNAC 1 cut(s) 925
MalI GATC 4 cut(s) 81, 738, 793, 888
MboI GATC 4 cut(s) 79, 736, 791, 886
MboII GAAGA 5 cut(s) 9, 439, 672, 877, 946
MfeI CAATTG 2 cut(s) 549, 890
MhlI GDGCHC 2 cut(s) 437, 664
MlsI TGGCCA 2 cut(s) 371, 983
MluCI AATT 5 cut(s) 236, 549, 890, 1029, 1045
MluNI TGGCCA 2 cut(s) 371, 983
MlyI GAGTC 2 cut(s) 61, 981
MmeI TCCRAC 3 cut(s) 80, 167, 509
Mox20I TGGCCA 2 cut(s) 371, 983
MroXI GAANNNNTTC 1 cut(s) 679
MscI TGGCCA 2 cut(s) 371, 983
MseI TTAA 3 cut(s) 252, 338, 711
MslI CAYNNNNRTG 4 cut(s) 90, 297, 303, 491
Msp20I TGGCCA 2 cut(s) 371, 983
MspCI CTTAAG 1 cut(s) 251
MunI CAATTG 2 cut(s) 549, 890
MwoI GCNNNNNNNGC 1 cut(s) 560
NcoI CCATGG 1 cut(s) 978
NdeII GATC 4 cut(s) 79, 736, 791, 886
NlaIII CATG 7 cut(s) 89, 286, 302, 347, 587, 687, 982
NlaIV GGNNCC 4 cut(s) 124, 141, 519, 573
NmuCI GTSAC 1 cut(s) 925
NspV TTCGAA 1 cut(s) 1033
PagI TCATGA 2 cut(s) 282, 583
PdmI GAANNNNTTC 1 cut(s) 679
PfeI GAWTC 2 cut(s) 4, 101
PkrI GCNGC 2 cut(s) 274, 472
PleI GAGTC 2 cut(s) 60, 980
PpsI GAGTC 2 cut(s) 60, 980
PspFI CCCAGC 1 cut(s) 70
PspN4I GGNNCC 4 cut(s) 124, 141, 519, 573
PspPI GGNCC 2 cut(s) 503, 517
PstI CTGCAG 2 cut(s) 472, 861
RseI CAYNNNNRTG 4 cut(s) 90, 297, 303, 491
SaqAI TTAA 3 cut(s) 252, 338, 711
SatI GCNGC 2 cut(s) 273, 471
Sau3AI GATC 4 cut(s) 79, 736, 791, 886
Sau96I GGNCC 2 cut(s) 503, 517
SchI GAGTC 2 cut(s) 61, 981
SduI GDGCHC 2 cut(s) 437, 664
SfaNI GCATC 3 cut(s) 313, 472, 802
SfcI CTRYAG 2 cut(s) 468, 857
SfuI TTCGAA 1 cut(s) 1033
SinI GGWCC 2 cut(s) 503, 517
SmiMI CAYNNNNRTG 4 cut(s) 90, 297, 303, 491
SmlI CTYRAG 1 cut(s) 251
SmoI CTYRAG 1 cut(s) 251
Sse9I AATT 5 cut(s) 236, 549, 890, 1029, 1045
SsiI CCGC 3 cut(s) 501, 930, 948
SspMI CTAG 1 cut(s) 276
StyI CCWWGG 3 cut(s) 366, 555, 978
TaaI ACNGT 4 cut(s) 139, 305, 445, 490
TaqI TCGA 3 cut(s) 423, 717, 1033
TasI AATT 5 cut(s) 236, 549, 890, 1029, 1045
TfiI GAWTC 2 cut(s) 4, 101
Tru1I TTAA 3 cut(s) 252, 338, 711
Tru9I TTAA 3 cut(s) 252, 338, 711
TscAI CASTG 3 cut(s) 119, 493, 844
TseFI GTSAC 1 cut(s) 925
TseI GCWGC 2 cut(s) 272, 470
Tsp45I GTSAC 1 cut(s) 925
TspDTI ATGAA 6 cut(s) 17, 114, 600, 672, 765, 1035
TspRI CASTG 3 cut(s) 119, 493, 844
Vha464I CTTAAG 1 cut(s) 251
VpaK11BI GGWCC 2 cut(s) 503, 517
XapI RAATTY 1 cut(s) 1029
XcmI CCANNNNNNNNNTGG 1 cut(s) 985
XmnI GAANNNNTTC 1 cut(s) 679
XspI CTAG 1 cut(s) 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.