Rmu_ssc0000399.1_g000019

Desiccation protectant protein Lea14 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000399.1
Physical Location & Seq
Reverse (-)
64404 .. 66655
2252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000399.1_g000019.1.cds

Sequence Viewer

Length: 888 bp
atgttgaagtcgacggagaatgtggagaaggaggttaataaggaggaggacaaaacagagaggtcgctgatgaaaatggctaagacgacggaggaggttaaggaggagggggatgaggctaagagggacaggtctttgatgggaatgtttaaatcgaaggaggaggcgaaggagaggtcgctgatgaaaatggctaagacgacggaggaggcagcggaggaggttaaggaggagggggatgaggctaagagggacaggtctttgatgggaatgtttaaatcgaaggaggaggcgaagaaggaggttgaggaggaggcgaaggaggctaagacggagcagtcgttgatagacaaggcgaagaactatgtggcagagaagatagcaaatgtgccaacgccagaggcaagtctggtcgatgttgatttcaagaaggtgagctttgattctgccgattaccttgccaaggttaacatcaaaaatccctattcacattccatccccatctgtgagatcgattacaccctcaaaagcactggcagtgtgatcgcttccgggaaaattccagaccctggatcgataaaggctagcggtgatactcaggtggatgtaccagtgaaagtgccacacagtataatagtgactttggttaaggacatcgctacagattgggacattgactatgagttggaactgggtctcatcattgaccttcctgtaattgggaacattaccataccactatccaggaaaggtgagatcaagcttcccaccttaaaggagttagtatttggagcaaaggaggaggagaaggattcaaaagaaaaagacatggattcaaaagaaaaagagaaggattcaaaagaaaaagataaggattcagataaatag

Protein Analysis

295

Amino Acids

33.11

Weight (kDa)

4.95

Isoelectric Point (pI)

41.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 337
AccB7I CCANNNNNTGG 1 cut(s) 569
AccI GTMKAC 1 cut(s) 11
AciI CCGC 2 cut(s) 215, 588
AclWI GGATC 1 cut(s) 580
AcsI RAATTY 1 cut(s) 558
AfaI GTAC 1 cut(s) 609
AfiI CCNNNNNNNGG 3 cut(s) 463, 569, 719
AgsI TTSAA 5 cut(s) 7, 427, 816, 837, 858
AjnI CCWGG 2 cut(s) 568, 743
AluBI AGCT 2 cut(s) 438, 763
AluI AGCT 2 cut(s) 438, 763
Alw26I GTCTC 1 cut(s) 701
AlwI GGATC 1 cut(s) 580
AlwNI CAGNNNCTG 1 cut(s) 569
ApeKI GCWGC 1 cut(s) 212
ApoI RAATTY 1 cut(s) 558
ArsI GACNNNNNNTTYG 2 cut(s) 161, 193
AsuC2I CCSGG 1 cut(s) 553
AsuHPI GGTGA 3 cut(s) 445, 602, 764
AsuNHI GCTAGC 1 cut(s) 584
BaeI ACNNNNGTAYC 2 cut(s) 585, 618
BbvI GCAGC 1 cut(s) 224
BccI CCATC 4 cut(s) 133, 259, 503, 509
BcgI CGANNNNNNTGC 4 cut(s) 440, 474, 526, 560
BciT130I CCWGG 2 cut(s) 570, 745
BcnI CCSGG 1 cut(s) 553
BcoDI GTCTC 1 cut(s) 701
BfaI CTAG 1 cut(s) 585
BfmI CTRYAG 1 cut(s) 660
BisI GCNGC 1 cut(s) 213
BlsI GCNGC 1 cut(s) 214
Bme1390I CCNGG 3 cut(s) 553, 570, 745
BmrFI CCNGG 3 cut(s) 553, 570, 745
BmrI ACTGGG 1 cut(s) 701
BmtI GCTAGC 1 cut(s) 588
BmuI ACTGGG 1 cut(s) 701
BpuMI CCSGG 1 cut(s) 553
Bsa29I ATCGAT 2 cut(s) 513, 575
BsaI GGTCTC 1 cut(s) 701
BsaJI CCNNGG 2 cut(s) 462, 568
BsaXI ACNNNNNCTCC 2 cut(s) 326, 356
Bsc4I CCNNNNNNNGG 3 cut(s) 463, 569, 719
Bse1I ACTGG 3 cut(s) 538, 611, 696
BseBI CCWGG 2 cut(s) 570, 745
BseCI ATCGAT 2 cut(s) 513, 575
BseDI CCNNGG 2 cut(s) 462, 568
BseGI GGATG 4 cut(s) 118, 244, 495, 610
BseLI CCNNNNNNNGG 3 cut(s) 463, 569, 719
BseMII CTCAG 1 cut(s) 611
BseNI ACTGG 3 cut(s) 538, 611, 696
BseXI GCAGC 1 cut(s) 224
BshVI ATCGAT 2 cut(s) 513, 575
BsiSI CCGG 1 cut(s) 552
BslFI GGGAC 3 cut(s) 140, 266, 683
BslI CCNNNNNNNGG 3 cut(s) 463, 569, 719
BsmAI GTCTC 1 cut(s) 701
BsmFI GGGAC 3 cut(s) 140, 266, 683
Bso31I GGTCTC 1 cut(s) 701
Bsp143I GATC 4 cut(s) 510, 543, 572, 756
BspACI CCGC 2 cut(s) 215, 588
BspCNI CTCAG 1 cut(s) 610
BspDI ATCGAT 2 cut(s) 513, 575
BspOI GCTAGC 1 cut(s) 588
BspPI GGATC 1 cut(s) 580
BspTNI GGTCTC 1 cut(s) 701
BsrI ACTGG 3 cut(s) 538, 611, 696
BssECI CCNNGG 2 cut(s) 462, 568
BssMI GATC 4 cut(s) 510, 543, 572, 756
BssT1I CCWWGG 1 cut(s) 462
Bst2UI CCWGG 2 cut(s) 570, 745
Bst4CI ACNGT 1 cut(s) 629
BstC8I GCNNGC 1 cut(s) 586
BstDEI CTNAG 6 cut(s) 81, 120, 195, 246, 327, 597
BstENI CCTNNNNNAGG 1 cut(s) 461
BstF5I GGATG 4 cut(s) 118, 244, 495, 610
BstKTI GATC 4 cut(s) 513, 546, 575, 759
BstMAI GTCTC 1 cut(s) 701
BstMBI GATC 4 cut(s) 510, 543, 572, 756
BstMWI GCNNNNNNNGC 1 cut(s) 323
BstNI CCWGG 2 cut(s) 570, 745
BstSCI CCNGG 3 cut(s) 551, 568, 743
BstSFI CTRYAG 1 cut(s) 660
BstV1I GCAGC 1 cut(s) 224
Bsu15I ATCGAT 2 cut(s) 513, 575
BsuTUI ATCGAT 2 cut(s) 513, 575
BtgZI GCGATG 1 cut(s) 640
BtsCI GGATG 4 cut(s) 118, 244, 495, 610
BtsI GCAGTG 1 cut(s) 544
BtsIMutI CAGTG 3 cut(s) 531, 544, 618
Cac8I GCNNGC 1 cut(s) 586
CaiI CAGNNNCTG 1 cut(s) 569
ClaI ATCGAT 2 cut(s) 513, 575
Csp6I GTAC 1 cut(s) 608
CviAII CATG 1 cut(s) 829
CviJI RGCY 8 cut(s) 80, 119, 194, 245, 326, 438, 584, 763
CviKI_1 RGCY 8 cut(s) 80, 119, 194, 245, 326, 438, 584, 763
CviQI GTAC 1 cut(s) 608
DdeI CTNAG 6 cut(s) 81, 120, 195, 246, 327, 597
DpnI GATC 4 cut(s) 512, 545, 574, 758
DpnII GATC 4 cut(s) 510, 543, 572, 756
DraI TTTAAA 2 cut(s) 151, 277
DrdI GACNNNNNNGTC 1 cut(s) 337
DseDI GACNNNNNNGTC 1 cut(s) 337
Eco130I CCWWGG 1 cut(s) 462
Eco31I GGTCTC 1 cut(s) 701
EcoNI CCTNNNNNAGG 1 cut(s) 461
EcoRII CCWGG 2 cut(s) 568, 743
EcoT14I CCWWGG 1 cut(s) 462
ErhI CCWWGG 1 cut(s) 462
FaeI CATG 1 cut(s) 832
FaiI YATR 5 cut(s) 366, 632, 681, 734, 830
FalI AAGNNNNNCTT 2 cut(s) 422, 454
FaqI GGGAC 3 cut(s) 140, 266, 683
FatI CATG 1 cut(s) 828
FblI GTMKAC 1 cut(s) 11
Fnu4HI GCNGC 1 cut(s) 213
FokI GGATG 4 cut(s) 125, 251, 482, 617
Fsp4HI GCNGC 1 cut(s) 213
FspBI CTAG 1 cut(s) 585
GluI GCNGC 1 cut(s) 213
HapII CCGG 1 cut(s) 552
Hin1II CATG 1 cut(s) 832
HincII GTYRAC 2 cut(s) 12, 469
HindII GTYRAC 2 cut(s) 12, 469
HindIII AAGCTT 1 cut(s) 761
HinfI GANTC 5 cut(s) 443, 812, 833, 854, 875
HpaI GTTAAC 1 cut(s) 469
HpaII CCGG 1 cut(s) 552
HphI GGTGA 3 cut(s) 445, 602, 764
Hpy166II GTNNAC 2 cut(s) 12, 469
Hpy188I TCNGA 1 cut(s) 880
Hpy188III TCNNGA 2 cut(s) 427, 563
Hpy8I GTNNAC 2 cut(s) 12, 469
Hpy99I CGWCG 3 cut(s) 16, 91, 205
HpyCH4III ACNGT 1 cut(s) 629
HpyF10VI GCNNNNNNNGC 1 cut(s) 323
HpyF3I CTNAG 6 cut(s) 81, 120, 195, 246, 327, 597
Hsp92II CATG 1 cut(s) 832
KspAI GTTAAC 1 cut(s) 469
Kzo9I GATC 4 cut(s) 510, 543, 572, 756
LmnI GCTCC 2 cut(s) 334, 791
Lsp1109I GCAGC 1 cut(s) 224
MaeI CTAG 1 cut(s) 585
MaeIII GTNAC 1 cut(s) 637
MalI GATC 4 cut(s) 512, 545, 574, 758
MboI GATC 4 cut(s) 510, 543, 572, 756
MboII GAAGA 3 cut(s) 307, 370, 388
MluCI AATT 2 cut(s) 558, 717
MmeI TCCRAC 1 cut(s) 666
MseI TTAA 8 cut(s) 36, 99, 150, 225, 276, 468, 648, 773
MspA1I CMGCKG 1 cut(s) 215
MspI CCGG 1 cut(s) 552
MspR9I CCNGG 3 cut(s) 553, 570, 745
MvaI CCWGG 2 cut(s) 570, 745
MwoI GCNNNNNNNGC 1 cut(s) 323
NciI CCSGG 1 cut(s) 553
NdeII GATC 4 cut(s) 510, 543, 572, 756
NheI GCTAGC 1 cut(s) 584
NlaIII CATG 1 cut(s) 832
NmuCI GTSAC 1 cut(s) 637
PcsI WCGNNNNNNNCGW 1 cut(s) 338
PfeI GAWTC 5 cut(s) 443, 812, 833, 854, 875
PflMI CCANNNNNTGG 1 cut(s) 569
PfoI TCCNGGA 2 cut(s) 551, 743
PkrI GCNGC 1 cut(s) 214
Psp6I CCWGG 2 cut(s) 568, 743
PspGI CCWGG 2 cut(s) 568, 743
PstNI CAGNNNCTG 1 cut(s) 569
RsaI GTAC 1 cut(s) 609
RsaNI GTAC 1 cut(s) 608
SalI GTCGAC 1 cut(s) 10
SaqAI TTAA 8 cut(s) 36, 99, 150, 225, 276, 468, 648, 773
SatI GCNGC 1 cut(s) 213
Sau3AI GATC 4 cut(s) 510, 543, 572, 756
ScrFI CCNGG 3 cut(s) 553, 570, 745
SfcI CTRYAG 1 cut(s) 660
Sse9I AATT 2 cut(s) 558, 717
SsiI CCGC 2 cut(s) 215, 588
SspMI CTAG 1 cut(s) 585
StyD4I CCNGG 3 cut(s) 551, 568, 743
StyI CCWWGG 1 cut(s) 462
TaaI ACNGT 1 cut(s) 629
TaqI TCGA 6 cut(s) 11, 155, 281, 414, 513, 575
TasI AATT 2 cut(s) 558, 717
TfiI GAWTC 5 cut(s) 443, 812, 833, 854, 875
Tru1I TTAA 8 cut(s) 36, 99, 150, 225, 276, 468, 648, 773
Tru9I TTAA 8 cut(s) 36, 99, 150, 225, 276, 468, 648, 773
TscAI CASTG 3 cut(s) 538, 544, 618
TseFI GTSAC 1 cut(s) 637
TseI GCWGC 1 cut(s) 212
Tsp45I GTSAC 1 cut(s) 637
TspDTI ATGAA 2 cut(s) 86, 200
TspGWI ACGGA 4 cut(s) 29, 104, 218, 347
TspRI CASTG 3 cut(s) 538, 544, 618
Van91I CCANNNNNTGG 1 cut(s) 569
XagI CCTNNNNNAGG 1 cut(s) 461
XapI RAATTY 1 cut(s) 558
XmiI GTMKAC 1 cut(s) 11
XspI CTAG 1 cut(s) 585
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.