Rroxscaffold_1G00048210

Protein of unknown function, DUF599

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
68182224 .. 68182971
748 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00048210.1

Sequence Viewer

Length: 564 bp
ATGTTGTGCTACCTTCTCTTTCTCCTCTACAGATGCCTACGGCATCCTGAAACCACAGTCATTGGCAATGAAAACCACTGCAGAAAAGCTTGTGTTGAGAGAATGTTGCAGATTGAAGCAAAGGATCGAGGTCAGTCCCTAGCAGTAATCTCCAGCACTATAACAGCAGCAAATTTCTTGGCTTCAACCTCTTTAGTCTTGAGTTCTTTGATTGGAACATGGGTTCTAAACTCTTCAAACAGCATCCTCCTCACTAGTTTTACAAGCTTTATCCACGCCACTTTCCTCATTAGCATGCCAAACAGTGATACTCCTCTGAGTGATGTTCAGAAGGCTGTGATACATGGCGGCCTTTTTTGGACATTGGGGTTGAGAGCAATCTATTTTGCCACTAATTTACTCCTCTGGGTTTTTGGTCCAATTCCGATGTTTGTGTGTTCAGTGACTTTGGTGTTGATTCTGAACAAGCTGGATTCAAATTCCACTCCATTGCATCAGTTCCAACCAGCCAGGAGTCATGACAATAGGTTGATGGGGAAACTTGCTGAAGAAAAACCCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

187

Amino Acids

20.81

Weight (kDa)

8.91

Isoelectric Point (pI)

31.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF599 PF04654 1 - 80 2e-14 Protein of unknown function, DUF599
DUF599 PF04654 86 - 162 6.3e-20 Protein of unknown function, DUF599
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 348
AclWI GGATC 1 cut(s) 132
AcsI RAATTY 2 cut(s) 172, 478
AgsI TTSAA 4 cut(s) 116, 186, 237, 477
AhlI ACTAGT 1 cut(s) 254
AjnI CCWGG 1 cut(s) 509
AloI GAACNNNNNNTCC 2 cut(s) 207, 239
AluBI AGCT 3 cut(s) 89, 267, 469
AluI AGCT 3 cut(s) 89, 267, 469
AlwI GGATC 1 cut(s) 132
AoxI GGCC 1 cut(s) 349
ApeKI GCWGC 1 cut(s) 167
ApoI RAATTY 2 cut(s) 172, 478
AspS9I GGNCC 1 cut(s) 416
AvaII GGWCC 1 cut(s) 416
BbvI GCAGC 1 cut(s) 179
BccI CCATC 1 cut(s) 526
BceAI ACGGC 1 cut(s) 56
BciT130I CCWGG 1 cut(s) 511
BcuI ACTAGT 1 cut(s) 254
BfaI CTAG 2 cut(s) 140, 255
BfmI CTRYAG 2 cut(s) 28, 79
BisI GCNGC 2 cut(s) 168, 349
BlsI GCNGC 2 cut(s) 169, 350
Bme1390I CCNGG 1 cut(s) 511
Bme18I GGWCC 1 cut(s) 416
BmgT120I GGNCC 1 cut(s) 416
BmrFI CCNGG 1 cut(s) 511
BmsI GCATC 4 cut(s) 23, 52, 252, 502
BpmI CTGGAG 1 cut(s) 136
BpuEI CTTGAG 1 cut(s) 220
Bse3DI GCAATG 2 cut(s) 73, 488
BseBI CCWGG 1 cut(s) 511
BseGI GGATG 2 cut(s) 43, 243
BseMI GCAATG 2 cut(s) 73, 488
BseMII CTCAG 1 cut(s) 308
BseRI GAGGAG 4 cut(s) 14, 239, 303, 392
BseXI GCAGC 1 cut(s) 179
BshFI GGCC 1 cut(s) 351
BslFI GGGAC 1 cut(s) 121
BsmFI GGGAC 1 cut(s) 121
BsnI GGCC 1 cut(s) 351
Bsp143I GATC 1 cut(s) 124
BspACI CCGC 1 cut(s) 348
BspANI GGCC 1 cut(s) 351
BspCNI CTCAG 1 cut(s) 309
BspHI TCATGA 1 cut(s) 517
BspMAI CTGCAG 1 cut(s) 83
BspPI GGATC 1 cut(s) 132
BsrDI GCAATG 2 cut(s) 73, 488
BssMI GATC 1 cut(s) 124
Bst2UI CCWGG 1 cut(s) 511
Bst4CI ACNGT 2 cut(s) 58, 305
Bst6I CTCTTC 1 cut(s) 238
BstC8I GCNNGC 1 cut(s) 296
BstDEI CTNAG 1 cut(s) 317
BstF5I GGATG 2 cut(s) 43, 243
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BstNI CCWGG 1 cut(s) 511
BstNSI RCATGY 1 cut(s) 298
BstSCI CCNGG 1 cut(s) 509
BstSFI CTRYAG 2 cut(s) 28, 79
BstV1I GCAGC 1 cut(s) 179
BsuRI GGCC 1 cut(s) 351
BtsCI GGATG 2 cut(s) 43, 243
BtsI GCAGTG 1 cut(s) 76
BtsIMutI CAGTG 3 cut(s) 76, 310, 447
Cac8I GCNNGC 1 cut(s) 296
CciI TCATGA 1 cut(s) 517
Cfr13I GGNCC 1 cut(s) 416
CspCI CAANNNNNGTGG 2 cut(s) 43, 78
CviAII CATG 4 cut(s) 219, 295, 344, 518
CviJI RGCY 7 cut(s) 89, 182, 267, 335, 351, 469, 509
CviKI_1 RGCY 7 cut(s) 89, 182, 267, 335, 351, 469, 509
DdeI CTNAG 1 cut(s) 317
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
Eam1104I CTCTTC 1 cut(s) 238
EarI CTCTTC 1 cut(s) 238
Eco47I GGWCC 1 cut(s) 416
EcoRII CCWGG 1 cut(s) 509
FaeI CATG 4 cut(s) 222, 298, 347, 521
FaiI YATR 5 cut(s) 161, 220, 296, 345, 519
FaqI GGGAC 1 cut(s) 121
FatI CATG 4 cut(s) 218, 294, 343, 517
Fnu4HI GCNGC 2 cut(s) 168, 349
FokI GGATG 2 cut(s) 30, 230
Fsp4HI GCNGC 2 cut(s) 168, 349
FspBI CTAG 2 cut(s) 140, 255
GluI GCNGC 2 cut(s) 168, 349
GsuI CTGGAG 1 cut(s) 136
HaeIII GGCC 1 cut(s) 351
Hin1II CATG 4 cut(s) 222, 298, 347, 521
HindIII AAGCTT 2 cut(s) 87, 265
HinfI GANTC 3 cut(s) 457, 473, 514
Hpy188I TCNGA 4 cut(s) 318, 330, 426, 462
Hpy188III TCNNGA 3 cut(s) 47, 199, 518
HpyAV CCTTC 2 cut(s) 23, 325
HpyCH4III ACNGT 2 cut(s) 58, 305
HpyCH4V TGCA 3 cut(s) 81, 109, 493
HpyF3I CTNAG 1 cut(s) 317
Hsp92II CATG 4 cut(s) 222, 298, 347, 521
Kzo9I GATC 1 cut(s) 124
LpnPI CCDG 7 cut(s) 60, 166, 391, 455, 496, 519, 523
Lsp1109I GCAGC 1 cut(s) 179
LweI GCATC 4 cut(s) 23, 52, 252, 502
MaeI CTAG 2 cut(s) 140, 255
MaeIII GTNAC 1 cut(s) 442
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MboII GAAGA 2 cut(s) 225, 560
MluCI AATT 4 cut(s) 172, 394, 420, 478
MlyI GAGTC 1 cut(s) 523
MmeI TCCRAC 1 cut(s) 526
MnlI CCTC 8 cut(s) 35, 122, 199, 257, 260, 296, 324, 413
MslI CAYNNNNRTG 1 cut(s) 293
MspR9I CCNGG 1 cut(s) 511
MvaI CCWGG 1 cut(s) 511
NdeII GATC 1 cut(s) 124
NlaIII CATG 4 cut(s) 222, 298, 347, 521
NmuCI GTSAC 1 cut(s) 442
NspI RCATGY 1 cut(s) 298
PaeI GCATGC 1 cut(s) 298
PagI TCATGA 1 cut(s) 517
PfeI GAWTC 2 cut(s) 457, 473
PkrI GCNGC 2 cut(s) 169, 350
PleI GAGTC 1 cut(s) 522
PpsI GAGTC 1 cut(s) 522
Psp6I CCWGG 1 cut(s) 509
PspGI CCWGG 1 cut(s) 509
PspPI GGNCC 1 cut(s) 416
PstI CTGCAG 1 cut(s) 83
RseI CAYNNNNRTG 1 cut(s) 293
SatI GCNGC 2 cut(s) 168, 349
Sau3AI GATC 1 cut(s) 124
Sau96I GGNCC 1 cut(s) 416
SchI GAGTC 1 cut(s) 523
ScrFI CCNGG 1 cut(s) 511
SetI ASST 7 cut(s) 15, 91, 133, 191, 269, 471, 530
SfaNI GCATC 4 cut(s) 23, 52, 252, 502
SfcI CTRYAG 2 cut(s) 28, 79
SinI GGWCC 1 cut(s) 416
SmiMI CAYNNNNRTG 1 cut(s) 293
SmlI CTYRAG 1 cut(s) 199
SmoI CTYRAG 1 cut(s) 199
SpeI ACTAGT 1 cut(s) 254
SphI GCATGC 1 cut(s) 298
Sse9I AATT 4 cut(s) 172, 394, 420, 478
SsiI CCGC 1 cut(s) 348
SspMI CTAG 2 cut(s) 140, 255
StyD4I CCNGG 1 cut(s) 509
TaaI ACNGT 2 cut(s) 58, 305
TaqI TCGA 1 cut(s) 127
TasI AATT 4 cut(s) 172, 394, 420, 478
TauI GCSGC 1 cut(s) 351
TfiI GAWTC 2 cut(s) 457, 473
TscAI CASTG 3 cut(s) 83, 310, 447
TseFI GTSAC 1 cut(s) 442
TseI GCWGC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 442
TspDTI ATGAA 1 cut(s) 84
TspRI CASTG 3 cut(s) 83, 310, 447
VpaK11BI GGWCC 1 cut(s) 416
XapI RAATTY 2 cut(s) 172, 478
XceI RCATGY 1 cut(s) 298
XspI CTAG 2 cut(s) 140, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.