Rroxscaffold_1G00067370

Protein of unknown function, DUF599

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
88682598 .. 88686845
4248 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00067370.1

Sequence Viewer

Length: 714 bp
ATGGGTTTTGGGAAGGATGATCTTGATTTGGTGTTGGTCCCAAGTGGATTGCTGATCATGTTTGTCTACCACATCAACCTTCTCTACAGATATCTTCATCTCCTCACACCACAGTCATTGGCTTTGAAAACAATGACAAAAGAGCTTGGGTTGAAAGAGTTATGCAGTTCCCTTATTGGAGCTTGGCTTGGAAGCAACACAAATGGGGTCTTTCAGAGTGAATTAGTCTACGGCAACACAAATCCATCAACGATTACCATCAAGTACATAACCCTCTTAACTTGCTTCCTTCTCGCATTCGCTTGCTTTGTTCAATCAGCAAGGCACTTTGTTCATGCCAACTACCTAATAAGCACACCAGACAGTAACATTCCAGCCTGGTATGTAGAGATGGCAGTCATAAGGGGTGGTGATTTTTGGTCACTTGGGCTAAGAGCTTTGTACTTTGCTCTTACTTTGCTTCTATGGTTTTTTGGTCCAATTCCAATGTTTGCCTCCTCCATTGTTCTGGTCATGGTCCTCCATTACCTTGACACAAACACCAGGCCAATGTTTCAGCATCAGTTTAAAGGAAGGGAGATGGTGAAGAAGGTTGAGGAGAGAATTTCAGAGGTAGCTGTGACCTCACGGCACCATCACACAGAAAAGTCAAAACAACCACCAAAGGAATGGCCCTTGGGTCAATTATTGGCACGAGGCAATAGTTGGCGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

237

Amino Acids

27.0

Weight (kDa)

9.11

Isoelectric Point (pI)

27.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF599 PF04654 55 - 181 2.4e-39 Protein of unknown function, DUF599
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 630
AccI GTMKAC 2 cut(s) 66, 228
AcsI RAATTY 1 cut(s) 603
AfaI GTAC 2 cut(s) 266, 443
AgsI TTSAA 3 cut(s) 127, 154, 314
AjnI CCWGG 2 cut(s) 377, 542
AluBI AGCT 4 cut(s) 145, 182, 437, 617
AluI AGCT 4 cut(s) 145, 182, 437, 617
AoxI GGCC 2 cut(s) 545, 671
ApoI RAATTY 1 cut(s) 603
AspS9I GGNCC 4 cut(s) 37, 476, 517, 672
AsuHPI GGTGA 2 cut(s) 422, 595
AvaII GGWCC 3 cut(s) 37, 476, 517
BanI GGYRCC 1 cut(s) 630
BauI CACGAG 1 cut(s) 693
BccI CCATC 5 cut(s) 253, 266, 385, 574, 642
BceAI ACGGC 2 cut(s) 247, 644
BciT130I CCWGG 2 cut(s) 379, 544
BclI TGATCA 1 cut(s) 54
BfmI CTRYAG 1 cut(s) 85
Bme1390I CCNGG 2 cut(s) 379, 544
Bme18I GGWCC 3 cut(s) 37, 476, 517
BmgT120I GGNCC 4 cut(s) 37, 476, 517, 672
BmiI GGNNCC 2 cut(s) 39, 632
BmrFI CCNGG 2 cut(s) 379, 544
BmsI GCATC 1 cut(s) 568
BsaBI GATNNNNATC 1 cut(s) 257
BsaJI CCNNGG 1 cut(s) 675
Bse8I GATNNNNATC 1 cut(s) 257
BseBI CCWGG 2 cut(s) 379, 544
BseDI CCNNGG 1 cut(s) 675
BseGI GGATG 1 cut(s) 22
BseJI GATNNNNATC 1 cut(s) 257
BseRI GAGGAG 3 cut(s) 92, 487, 611
BshFI GGCC 2 cut(s) 547, 673
BshNI GGYRCC 1 cut(s) 630
BslFI GGGAC 1 cut(s) 23
BsmFI GGGAC 1 cut(s) 23
BsmI GAATGC 1 cut(s) 296
BsnI GGCC 2 cut(s) 547, 673
Bsp143I GATC 2 cut(s) 19, 54
BspANI GGCC 2 cut(s) 547, 673
BspLI GGNNCC 2 cut(s) 39, 632
BspT107I GGYRCC 1 cut(s) 630
BssECI CCNNGG 1 cut(s) 675
BssMI GATC 2 cut(s) 19, 54
BssSI CACGAG 1 cut(s) 693
BssT1I CCWWGG 1 cut(s) 675
Bst2BI CACGAG 1 cut(s) 693
Bst2UI CCWGG 2 cut(s) 379, 544
Bst4CI ACNGT 2 cut(s) 114, 365
BstC8I GCNNGC 1 cut(s) 304
BstDEI CTNAG 1 cut(s) 431
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 2 cut(s) 22, 57
BstMBI GATC 2 cut(s) 19, 54
BstNI CCWGG 2 cut(s) 379, 544
BstSCI CCNGG 2 cut(s) 377, 542
BstSFI CTRYAG 1 cut(s) 85
BstXI CCANNNNNNTGG 2 cut(s) 508, 669
BsuRI GGCC 2 cut(s) 547, 673
BtsCI GGATG 1 cut(s) 22
Cac8I GCNNGC 1 cut(s) 304
Cfr13I GGNCC 4 cut(s) 37, 476, 517, 672
Csp6I GTAC 2 cut(s) 265, 442
CspCI CAANNNNNGTGG 2 cut(s) 99, 134
CviAII CATG 3 cut(s) 58, 335, 514
CviQI GTAC 2 cut(s) 265, 442
DdeI CTNAG 1 cut(s) 431
DpnI GATC 2 cut(s) 21, 56
DpnII GATC 2 cut(s) 19, 54
DraI TTTAAA 1 cut(s) 568
Eco130I CCWWGG 1 cut(s) 675
Eco32I GATATC 1 cut(s) 92
Eco47I GGWCC 3 cut(s) 37, 476, 517
EcoRII CCWGG 2 cut(s) 377, 542
EcoRV GATATC 1 cut(s) 92
EcoT14I CCWWGG 1 cut(s) 675
ErhI CCWWGG 1 cut(s) 675
FaeI CATG 3 cut(s) 61, 338, 517
FaiI YATR 8 cut(s) 59, 163, 269, 336, 384, 401, 466, 515
FaqI GGGAC 1 cut(s) 23
FatI CATG 3 cut(s) 57, 334, 513
FbaI TGATCA 1 cut(s) 54
FblI GTMKAC 2 cut(s) 66, 228
FokI GGATG 1 cut(s) 29
HaeIII GGCC 2 cut(s) 547, 673
Hin1II CATG 3 cut(s) 61, 338, 517
HphI GGTGA 2 cut(s) 422, 595
Hpy166II GTNNAC 2 cut(s) 67, 229
Hpy188I TCNGA 2 cut(s) 216, 610
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 2 cut(s) 67, 229
HpyAV CCTTC 5 cut(s) 7, 89, 299, 567, 583
HpyCH4III ACNGT 2 cut(s) 114, 365
HpyCH4V TGCA 1 cut(s) 165
HpyF3I CTNAG 1 cut(s) 431
Hsp92II CATG 3 cut(s) 61, 338, 517
Ksp22I TGATCA 1 cut(s) 54
Kzo9I GATC 2 cut(s) 19, 54
LmnI GCTCC 1 cut(s) 179
LpnPI CCDG 7 cut(s) 364, 372, 387, 391, 494, 529, 556
LweI GCATC 1 cut(s) 568
MaeIII GTNAC 3 cut(s) 365, 420, 619
MalI GATC 2 cut(s) 21, 56
MboI GATC 2 cut(s) 19, 54
MboII GAAGA 2 cut(s) 86, 598
MluCI AATT 4 cut(s) 221, 480, 603, 683
MnlI CCTC 9 cut(s) 113, 284, 505, 508, 530, 589, 604, 634, 689
MseI TTAA 2 cut(s) 278, 567
MspR9I CCNGG 2 cut(s) 379, 544
Mva1269I GAATGC 1 cut(s) 296
MvaI CCWGG 2 cut(s) 379, 544
NdeII GATC 2 cut(s) 19, 54
NlaIII CATG 3 cut(s) 61, 338, 517
NlaIV GGNNCC 2 cut(s) 39, 632
NmuCI GTSAC 2 cut(s) 420, 619
PctI GAATGC 1 cut(s) 296
Psp6I CCWGG 2 cut(s) 377, 542
PspGI CCWGG 2 cut(s) 377, 542
PspN4I GGNNCC 2 cut(s) 39, 632
PspPI GGNCC 4 cut(s) 37, 476, 517, 672
RsaI GTAC 2 cut(s) 266, 443
RsaNI GTAC 2 cut(s) 265, 442
SaqAI TTAA 2 cut(s) 278, 567
Sau3AI GATC 2 cut(s) 19, 54
Sau96I GGNCC 4 cut(s) 37, 476, 517, 672
ScrFI CCNGG 2 cut(s) 379, 544
SfaNI GCATC 1 cut(s) 568
SfcI CTRYAG 1 cut(s) 85
SinI GGWCC 3 cut(s) 37, 476, 517
Sse9I AATT 4 cut(s) 221, 480, 603, 683
StyD4I CCNGG 2 cut(s) 377, 542
StyI CCWWGG 1 cut(s) 675
TaaI ACNGT 2 cut(s) 114, 365
TasI AATT 4 cut(s) 221, 480, 603, 683
TatI WGTACW 2 cut(s) 264, 441
Tru1I TTAA 2 cut(s) 278, 567
Tru9I TTAA 2 cut(s) 278, 567
TseFI GTSAC 2 cut(s) 420, 619
Tsp45I GTSAC 2 cut(s) 420, 619
TspDTI ATGAA 2 cut(s) 86, 323
VpaK11BI GGWCC 3 cut(s) 37, 476, 517
XapI RAATTY 1 cut(s) 603
XcmI CCANNNNNNNNNTGG 1 cut(s) 666
XmiI GTMKAC 2 cut(s) 66, 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.