Rroxscaffold_2G00117190

protein import into mitochondrial matrix

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001400
Physical Location & Seq
Reverse (-)
44699153 .. 44699522
370 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00117190.1

Sequence Viewer

Length: 276 bp
ATGGCCGACAGTGTGCTCGATGTTTGGATACCCGGAAAAACGAAGGATGGAGATGAAATCCCTCATTACGGTGAGTTTGGATTTAGTACCCAGCCACGAACAAATGAAGACCACTTTCCACCAACCGAAATCTCGATCCAAATCGACCTTCTCCAAGCCGAAGATGTCCTTGCATCTCCGGCAATTCCGTTGATGAAGCTCGTAGGTCCGAAGGTGGTGGAGATAGCGATGGAGGGCTGGTTCACCTCCTTCATCATCCAAACAGATTCGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.09

Weight (kDa)

4.19

Isoelectric Point (pI)

39.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 130
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 88
AfiI CCNNNNNNNGG 1 cut(s) 68
AjuI GAANNNNNNNTTGG 2 cut(s) 132, 164
AloI GAACNNNNNNTCC 2 cut(s) 224, 256
AluBI AGCT 1 cut(s) 199
AluI AGCT 1 cut(s) 199
Alw21I GWGCWC 1 cut(s) 18
AlwI GGATC 1 cut(s) 130
AoxI GGCC 1 cut(s) 3
AspS9I GGNCC 1 cut(s) 206
AsuC2I CCSGG 1 cut(s) 33
AsuHPI GGTGA 2 cut(s) 83, 235
AvaII GGWCC 1 cut(s) 206
BbsI GAAGAC 1 cut(s) 114
Bbv12I GWGCWC 1 cut(s) 18
BccI CCATC 2 cut(s) 41, 223
BciVI GTATCC 1 cut(s) 21
BcnI CCSGG 1 cut(s) 33
BfuI GTATCC 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 33
Bme18I GGWCC 1 cut(s) 206
BmgT120I GGNCC 1 cut(s) 206
BmrFI CCNGG 1 cut(s) 33
BmsI GCATC 1 cut(s) 182
BpiI GAAGAC 1 cut(s) 114
BpuMI CCSGG 1 cut(s) 33
BsaBI GATNNNNATC 1 cut(s) 140
BsaXI ACNNNNNCTCC 2 cut(s) 224, 254
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse8I GATNNNNATC 1 cut(s) 140
BseGI GGATG 2 cut(s) 52, 255
BseJI GATNNNNATC 1 cut(s) 140
BseLI CCNNNNNNNGG 1 cut(s) 68
BseYI CCCAGC 1 cut(s) 90
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 18
BsiSI CCGG 2 cut(s) 33, 179
BslI CCNNNNNNNGG 1 cut(s) 68
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 18
Bsp143I GATC 1 cut(s) 135
BspANI GGCC 1 cut(s) 5
BspPI GGATC 1 cut(s) 130
BssMI GATC 1 cut(s) 135
Bst4CI ACNGT 2 cut(s) 11, 71
BstF5I GGATG 2 cut(s) 52, 255
BstKTI GATC 1 cut(s) 138
BstMBI GATC 1 cut(s) 135
BstMWI GCNNNNNNNGC 1 cut(s) 179
BstSCI CCNGG 1 cut(s) 31
BstV2I GAAGAC 1 cut(s) 114
BsuI GTATCC 1 cut(s) 21
BsuRI GGCC 1 cut(s) 5
BtgZI GCGATG 1 cut(s) 242
BtsCI GGATG 2 cut(s) 52, 255
BtsIMutI CAGTG 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 206
Csp6I GTAC 1 cut(s) 87
CviJI RGCY 5 cut(s) 5, 94, 158, 199, 237
CviKI_1 RGCY 5 cut(s) 5, 94, 158, 199, 237
CviQI GTAC 1 cut(s) 87
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 206
FalI AAGNNNNNCTT 2 cut(s) 153, 185
FokI GGATG 2 cut(s) 59, 242
GsaI CCCAGC 1 cut(s) 94
HaeIII GGCC 1 cut(s) 5
HapII CCGG 2 cut(s) 33, 179
HinfI GANTC 1 cut(s) 266
HpaII CCGG 2 cut(s) 33, 179
HphI GGTGA 2 cut(s) 83, 235
Hpy166II GTNNAC 1 cut(s) 243
Hpy188I TCNGA 1 cut(s) 210
Hpy188III TCNNGA 1 cut(s) 133
Hpy8I GTNNAC 1 cut(s) 243
HpyAV CCTTC 4 cut(s) 37, 158, 205, 259
HpyCH4III ACNGT 2 cut(s) 11, 71
HpyCH4V TGCA 1 cut(s) 173
HpyF10VI GCNNNNNNNGC 1 cut(s) 179
Kzo9I GATC 1 cut(s) 135
LpnPI CCDG 4 cut(s) 46, 104, 192, 223
LweI GCATC 1 cut(s) 182
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MboII GAAGA 2 cut(s) 119, 173
MhlI GDGCHC 1 cut(s) 18
MluCI AATT 1 cut(s) 183
MnlI CCTC 3 cut(s) 72, 226, 256
MslI CAYNNNNRTG 1 cut(s) 69
MspI CCGG 2 cut(s) 33, 179
MspR9I CCNGG 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 179
NciI CCSGG 1 cut(s) 33
NdeII GATC 1 cut(s) 135
PfeI GAWTC 1 cut(s) 266
PspFI CCCAGC 1 cut(s) 90
PspPI GGNCC 1 cut(s) 206
RsaI GTAC 1 cut(s) 88
RsaNI GTAC 1 cut(s) 87
RseI CAYNNNNRTG 1 cut(s) 69
Sau3AI GATC 1 cut(s) 135
Sau96I GGNCC 1 cut(s) 206
ScrFI CCNGG 1 cut(s) 33
SduI GDGCHC 1 cut(s) 18
SetI ASST 5 cut(s) 150, 201, 208, 216, 248
SfaNI GCATC 1 cut(s) 182
SinI GGWCC 1 cut(s) 206
SmiMI CAYNNNNRTG 1 cut(s) 69
Sse9I AATT 1 cut(s) 183
StyD4I CCNGG 1 cut(s) 31
TaaI ACNGT 2 cut(s) 11, 71
TaqI TCGA 4 cut(s) 18, 134, 144, 269
TasI AATT 1 cut(s) 183
TfiI GAWTC 1 cut(s) 266
TscAI CASTG 1 cut(s) 16
TspDTI ATGAA 4 cut(s) 69, 120, 209, 241
TspGWI ACGGA 1 cut(s) 177
TspRI CASTG 1 cut(s) 16
VpaK11BI GGWCC 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.