Rh6AG227000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0001400
Physical Location & Seq
Reverse (-)
40956942 .. 40963685
6744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG227000.1

Sequence Viewer

Length: 177 bp
ATGGCCGATGGTGCGCTTGATGTTTGGATACCCAGAAAAACAGAGGATGGAGATGACATCCCTCATTACGCAAGGTGGGATTGTCTTCTTGGGAGTTCCGATCTCTGGGTAATGGAAACTGTCCTAGAACCCAGAGATGGCTCTTTTTCAGGATGGGAGTTCGCAAGGCTGGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.6

Weight (kDa)

4.21

Isoelectric Point (pI)

48.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AfiI CCNNNNNNNGG 2 cut(s) 105, 137
AoxI GGCC 1 cut(s) 3
AspLEI GCGC 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 77
BccI CCATC 4 cut(s) 2, 41, 131, 147
BciVI GTATCC 1 cut(s) 21
BfaI CTAG 1 cut(s) 125
BfuI GTATCC 1 cut(s) 21
BpiI GAAGAC 1 cut(s) 77
Bsc4I CCNNNNNNNGG 2 cut(s) 105, 137
BseGI GGATG 3 cut(s) 52, 57, 158
BseLI CCNNNNNNNGG 2 cut(s) 105, 137
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 2 cut(s) 105, 137
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 100
BspANI GGCC 1 cut(s) 5
BssMI GATC 1 cut(s) 100
Bst4CI ACNGT 1 cut(s) 121
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 3 cut(s) 52, 57, 158
BstHHI GCGC 1 cut(s) 16
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
BstMWI GCNNNNNNNGC 2 cut(s) 11, 170
BstV2I GAAGAC 1 cut(s) 77
BsuI GTATCC 1 cut(s) 21
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 3 cut(s) 52, 57, 158
Cac8I GCNNGC 1 cut(s) 171
CfoI GCGC 1 cut(s) 16
CviJI RGCY 4 cut(s) 5, 141, 169, 173
CviKI_1 RGCY 4 cut(s) 5, 141, 169, 173
DdeI CTNAG 1 cut(s) 174
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
EaeI YGGCCR 1 cut(s) 3
FalI AAGNNNNNCTT 1 cut(s) 157
FokI GGATG 3 cut(s) 44, 59, 165
FspBI CTAG 1 cut(s) 125
GlaI GCGC 1 cut(s) 15
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 16
Hin6I GCGC 1 cut(s) 14
HinP1I GCGC 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 100
Hpy188III TCNNGA 1 cut(s) 150
HpyCH4III ACNGT 1 cut(s) 121
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 170
HpyF3I CTNAG 1 cut(s) 174
HspAI GCGC 1 cut(s) 14
Kzo9I GATC 1 cut(s) 100
LpnPI CCDG 5 cut(s) 46, 91, 135, 145, 155
MaeI CTAG 1 cut(s) 125
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MboII GAAGA 1 cut(s) 77
MnlI CCTC 2 cut(s) 37, 72
MwoI GCNNNNNNNGC 2 cut(s) 11, 170
NdeII GATC 1 cut(s) 100
Sau3AI GATC 1 cut(s) 100
SetI ASST 1 cut(s) 77
SgeI CNNG 8 cut(s) 29, 45, 84, 101, 118, 137, 144, 162
SspMI CTAG 1 cut(s) 125
TaaI ACNGT 1 cut(s) 121
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.