Rroxscaffold_3G00223390

agmatine

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
6489203 .. 6493884
4682 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00223390.1

Sequence Viewer

Length: 180 bp
ATGATTCTCGAAGGTGGAAGCATCCATGTAGATGGAGAAGGCACTTGCCTCACTACTGAGGAATGCCTCCTAAATAAAAACAGGAACCCTAATTTGACCAAGGAGCAAATAAAGGATCAACTTAAGGCATATCTTGGAGTGACGAAGATTATTTGGTTGCCCTGTGGATTGTATGGATGA

Protein Analysis

59

Amino Acids

6.53

Weight (kDa)

5.64

Isoelectric Point (pI)

40.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAD_porph PF04371 1 - 59 1.4e-26 Porphyromonas-type peptidyl-arginine deiminase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 123
AflII CTTAAG 1 cut(s) 122
AlwI GGATC 1 cut(s) 123
BccI CCATC 1 cut(s) 26
BfrI CTTAAG 1 cut(s) 122
BmiI GGNNCC 1 cut(s) 86
BmsI GCATC 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 99
BseDI CCNNGG 1 cut(s) 99
BseGI GGATG 1 cut(s) 21
BseMII CTCAG 1 cut(s) 48
BsmI GAATGC 1 cut(s) 68
Bsp143I GATC 1 cut(s) 115
BspCNI CTCAG 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 86
BspPI GGATC 1 cut(s) 123
BspTI CTTAAG 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 99
BssMI GATC 1 cut(s) 115
BssT1I CCWWGG 1 cut(s) 99
BstAFI CTTAAG 1 cut(s) 122
BstDEI CTNAG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 21
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstXI CCANNNNNNTGG 1 cut(s) 32
BtsCI GGATG 1 cut(s) 21
CviAII CATG 1 cut(s) 26
DdeI CTNAG 1 cut(s) 57
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
Eco130I CCWWGG 1 cut(s) 99
EcoT14I CCWWGG 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 99
FaeI CATG 1 cut(s) 29
FaiI YATR 3 cut(s) 27, 130, 174
FatI CATG 1 cut(s) 25
FokI GGATG 1 cut(s) 8
Hin1II CATG 1 cut(s) 29
HinfI GANTC 1 cut(s) 4
Hpy188III TCNNGA 1 cut(s) 8
HpyAV CCTTC 2 cut(s) 5, 32
HpyF3I CTNAG 1 cut(s) 57
Hsp92II CATG 1 cut(s) 29
Kzo9I GATC 1 cut(s) 115
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 2 cut(s) 67, 175
LweI GCATC 1 cut(s) 30
MaeIII GTNAC 1 cut(s) 139
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 1 cut(s) 157
MluCI AATT 1 cut(s) 91
MnlI CCTC 3 cut(s) 52, 59, 77
MseI TTAA 1 cut(s) 123
MslI CAYNNNNRTG 1 cut(s) 30
MspCI CTTAAG 1 cut(s) 122
Mva1269I GAATGC 1 cut(s) 68
NdeII GATC 1 cut(s) 115
NlaIII CATG 1 cut(s) 29
NlaIV GGNNCC 1 cut(s) 86
NmuCI GTSAC 1 cut(s) 139
PctI GAATGC 1 cut(s) 68
PfeI GAWTC 1 cut(s) 4
PspN4I GGNNCC 1 cut(s) 86
RseI CAYNNNNRTG 1 cut(s) 30
SaqAI TTAA 1 cut(s) 123
Sau3AI GATC 1 cut(s) 115
SetI ASST 1 cut(s) 16
SfaNI GCATC 1 cut(s) 30
SgeI CNNG 7 cut(s) 20, 38, 57, 94, 112, 146, 174
SmiMI CAYNNNNRTG 1 cut(s) 30
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
Sse9I AATT 1 cut(s) 91
StyI CCWWGG 1 cut(s) 99
TaqI TCGA 1 cut(s) 9
TasI AATT 1 cut(s) 91
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TseFI GTSAC 1 cut(s) 139
Tsp45I GTSAC 1 cut(s) 139
Vha464I CTTAAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.