Rroxscaffold_3G00245330

Belongs to the glycosyl hydrolase 31 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
38242745 .. 38249769
7025 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00245330.1

Sequence Viewer

Length: 162 bp
ATGCCTGCAATACCACAGCTGTTTGCGGTGATGTGTTACCAATGTAGGTGGAATTATAGAAATAAAGAGGATGTGGAGCAAGTTGATTCTAAGTGTGATGAGCATGATGTTCCGTATGATGTTTTGTGGCTTGTTATTGATCACACGGATGGAAAGAGGTGA

Protein Analysis

53

Amino Acids

6.37

Weight (kDa)

4.78

Isoelectric Point (pI)

67.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_31_2nd PF01055 2 - 51 2.2e-10 Glycosyl hydrolases family 31 TIM-barrel domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 26
AluBI AGCT 1 cut(s) 19
AluI AGCT 1 cut(s) 19
AsuHPI GGTGA 1 cut(s) 40
BccI CCATC 1 cut(s) 143
BclI TGATCA 1 cut(s) 139
BseGI GGATG 2 cut(s) 76, 154
Bsp143I GATC 1 cut(s) 139
BspACI CCGC 1 cut(s) 26
BssMI GATC 1 cut(s) 139
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 90
BstF5I GGATG 2 cut(s) 76, 154
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BtsCI GGATG 2 cut(s) 76, 154
Cac8I GCNNGC 1 cut(s) 6
CspCI CAANNNNNGTGG 2 cut(s) 29, 64
CviAII CATG 1 cut(s) 104
CviJI RGCY 2 cut(s) 19, 130
CviKI_1 RGCY 2 cut(s) 19, 130
DdeI CTNAG 1 cut(s) 90
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
FaeI CATG 1 cut(s) 107
FaiI YATR 3 cut(s) 57, 105, 117
FatI CATG 1 cut(s) 103
FbaI TGATCA 1 cut(s) 139
FokI GGATG 1 cut(s) 83
Hin1II CATG 1 cut(s) 107
HinfI GANTC 1 cut(s) 86
HphI GGTGA 1 cut(s) 40
HpyCH4V TGCA 1 cut(s) 8
HpyF3I CTNAG 1 cut(s) 90
Hsp92II CATG 1 cut(s) 107
Ksp22I TGATCA 1 cut(s) 139
Kzo9I GATC 1 cut(s) 139
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 1 cut(s) 18
MaeIII GTNAC 1 cut(s) 35
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MluCI AATT 1 cut(s) 52
MnlI CCTC 2 cut(s) 61, 150
MslI CAYNNNNRTG 1 cut(s) 147
MspA1I CMGCKG 1 cut(s) 19
NdeII GATC 1 cut(s) 139
NlaIII CATG 1 cut(s) 107
PfeI GAWTC 1 cut(s) 86
PvuII CAGCTG 1 cut(s) 19
RseI CAYNNNNRTG 1 cut(s) 147
Sau3AI GATC 1 cut(s) 139
SetI ASST 3 cut(s) 21, 50, 161
SgeI CNNG 5 cut(s) 17, 92, 116, 143, 157
SmiMI CAYNNNNRTG 1 cut(s) 147
Sse9I AATT 1 cut(s) 52
SsiI CCGC 1 cut(s) 26
TasI AATT 1 cut(s) 52
TfiI GAWTC 1 cut(s) 86
TspGWI ACGGA 2 cut(s) 102, 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.